Direkt zum Inhalt
Merck

EHU077521

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE2C

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCTCATGATGTCTGGCGATAAAGGGATTTCTGCCTTCCCTGAATCAGACAACCTTTTCAAATGGGTAGGGACCATCCATGGAGCAGCTGGAACAGTATATGAAGACCTGAGGTATAAGCTCTCGCTAGAGTTCCCCAGTGGCTACCCTTACAATGCGCCCACAGTGAAGTTCCTCACGCCCTGCTATCACCCCAACGTGGACACCCAGGGTAACATATGCCTGGACATCCTGAAGGAAAAGTGGTCTGCCCTGTATGATGTCAGGACCATTCTGCTCTCCATCCAGAGCCTTCTAGGAGAACCCAACATTGATAGTCCCTTGAACACACATGCTGCCGAGCTCTGGAAAAACCCCACAGCTTTTAAGAAGTACCTGCAAGAAACCTACTCAAAGCAGGTCACCAGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Liang Guo et al.
Cell cycle (Georgetown, Tex.), 16(18), 1705-1718 (2017-08-03)
Ubiquitin-conjugating enzyme E2C (UBE2C) is characterized as a crucial molecule in cancer cell growth that plays an essential role in the development of gliomas, but the detailed mechanisms have not been fully elucidated. In this study, we found that Forkhead
Xianxing Wang et al.
The FEBS journal, 286(24), 4889-4909 (2019-11-13)
Ubiquitin-conjugating enzyme 2C (UBE2C) is a core ubiquitin-conjugating enzyme in the ubiquitin-proteasome system that promotes cell cycle progression. Previous studies have indicated that UBE2C mediates tumorigenesis and progression in various cancers, but its role in pancreatic ductal adenocarcinoma (PDAC) remains
Rui Wang et al.
International journal of oncology, 50(4), 1116-1126 (2017-03-06)
The ubiquitin-conjugating enzyme 2C (UBE2C) is the key component in the ubiquitin proteasome system (UPS) by partnering with the anaphase‑promoting complex (APC/C). A high UBE2C protein expression level has been reported in various types of human tumors. However, little is known about the precise mechanism
Joan Fernandez Esmerats et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(3), 467-481 (2019-01-04)
Objective- Calcific aortic valve (AV) disease, characterized by AV sclerosis and calcification, is a major cause of death in the aging population; however, there are no effective medical therapies other than valve replacement. AV calcification preferentially occurs on the fibrosa
Qingshui Wang et al.
Biomolecules, 9(4) (2019-04-20)
Death Associated Protein Kinase 1 (DAPK1) is an important signaling kinase mediating the biological effect of multiple natural biomolecules such as IFN-γ, TNF-α, curcumin, etc. DAPK1 is degraded through both ubiquitin-proteasomal and lysosomal degradation pathways. To investigate the crosstalk between

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.