Direkt zum Inhalt
Merck

EHU076751

Sigma-Aldrich

MISSION® esiRNA

targeting human BRD4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAACCCTAACAAGCCCAAGAGGCAGACCAACCAACTGCAATACCTGCTCAGAGTGGTGCTCAAGACACTATGGAAACACCAGTTTGCATGGCCTTTCCAGCAGCCTGTGGATGCCGTCAAGCTGAACCTCCCTGATTACTATAAGATCATTAAAACGCCTATGGATATGGGAACAATAAAGAAGCGCTTGGAAAACAACTATTACTGGAATGCTCAGGAATGTATCCAGGACTTCAACACTATGTTTACAAATTGTTACATCTACAACAAGCCTGGAGATGACATAGTCTTAATGGCAGAAGCTCTGGAAAAGCTCTTCTTGCAAAAAATAAATGAGCTACCCACAGAAGAAACCGAGATCATGATAGTCCAGGCAAAAGGAAGAGGACGTGGGAGGAAAGAAACA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zeynab Najafova et al.
Nucleic acids research, 45(1), 127-141 (2016-09-22)
Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we
Stella Liong et al.
Reproduction (Cambridge, England), 155(6), 573-582 (2018-05-12)
Preeclampsia affects 5% of all pregnancies and is a serious disorder of pregnancy, characterised by high maternal blood pressure, placental hypoxia, fluid retention (oedema) and proteinuria. Women with preeclampsia are associated with exaggerated levels of pro-inflammatory cytokines, chemokines and anti-angiogenic
Hong Zuo et al.
Biochimie, 165, 100-107 (2019-07-22)
High glucose (HG)-induced podocyte injury contributes to the pathogenesis of diabetic nephropathy, a severe complication of diabetes. Bromodomain-containing protein 4 (BRD4) has emerged as a critical regulator for cell injury. However, whether BRD4 participates in HG-induced podocyte injury remains unclear.
Kun Tang et al.
American journal of physiology. Lung cellular and molecular physiology, 316(4), L621-L629 (2019-01-18)
Chronic obstructive pulmonary disease (COPD) is a common chronic airway inflammatory disease. MicroRNAs are shown to be involved in the regulation of inflammation. We investigated the role of microRNA-29b (miR-29b) in the airway inflammation in COPD. The expression of miR-29b
Sushmita Mustafi et al.
EBioMedicine, 43, 201-210 (2019-04-13)
Bromodomain and extra-terminal inhibitors (BETi) have shown efficacy for the treatment of aggressive triple negative breast cancer (TNBC). However, BETi are plagued by a narrow therapeutic window as manifested by severe toxicities at effective doses. Therefore, it is a limitation

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.