Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU074691

Sigma-Aldrich

MISSION® esiRNA

targeting human GABPA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCAGAGTGCACAGAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAACCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGTCTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAACCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTTGAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAACAAGTGACAAGATGGGCTGCT

Ensembl | Human Hinterlegungsnummer

ENSG00000154727

NCBI-Hinterlegungsnummer

NM_002040

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... GABPA(2551) , GABPA(2551)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lingjie Bao et al.
Molecular carcinogenesis, 56(6), 1543-1553 (2017-01-24)
Previously, we have demonstrated that NRF2 plays a key role in mediating cisplatin resistance in ovarian cancer. To further explore the mechanism underlying NRF2-dependent cisplatin resistance, we stably overexpressed or knocked down NRF2 in parental and cisplatin-resistant human ovarian cancer
Yasutaka Mitamura et al.
Oxidative medicine and cellular longevity, 2018, 2475047-2475047 (2018-09-07)
Systemic fibrosing or sclerotic disorders are life-threatening, but only very limited treatment modalities are available for them. In recent years, periostin (POSTN), a major extracellular matrix component, was established by several studies as a novel key player in the progression
Yun Peng Shao et al.
Neurourology and urodynamics, 37(8), 2470-2479 (2018-06-20)
The present work evaluated preventive effect of curcumin on cisplatin-induced bladder cystopathy. Fifteen female rats were divided into (i) Control group administered with physiological saline solution for 5 days; (ii) Cis-P group injected with cisplatin (6 mg/kg); and (iii) Cis-Cur group
Kanako Ono et al.
Placenta, 75, 34-41 (2019-02-05)
Polyunsaturated fatty acids (PUFAs), including arachidonic acid (AA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA), are essential for adequate fetal growth. The aim of the present study was to elucidate the effects of PUFAs on the expression and function of
Limin Xu et al.
Frontiers in cell and developmental biology, 8, 569977-569977 (2020-10-31)
Cerebral ischemic injury is a complicated pathological process. Adipose-derived stromal cells (ADSCs) have been used as a therapeutic strategy, with their therapeutic effects chiefly attributed to paracrine action rather than trans-differentiation. Studies have shown that circAkap7 was found to be
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.