Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU072741

Sigma-Aldrich

MISSION® esiRNA

targeting human RORA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGTGCCTTTGACTCTCAGAACAACACCGTGTACTTTGATGGGAAGTATGCCAGCCCCGACGTCTTCAAATCCTTAGGTTGTGAAGACTTTATTAGCTTTGTGTTTGAATTTGGAAAGAGTTTATGTTCTATGCACCTGACTGAAGATGAAATTGCATTATTTTCTGCATTTGTACTGATGTCAGCAGATCGCTCATGGCTGCAAGAAAAGGTAAAAATTGAAAAACTGCAACAGAAAATTCAGCTAGCTCTTCAACACGTCCTACAGAAGAATCACCGAGAAGATGGAATACTAACAAAGTTAATATGCAAGGTGTCTACCTTAAGAGCCTTATGTGGACGACATACAGAAAAGCTAATGGCATTTAAAGCAATATACCCAGACATTGTGCGACTTCATTTTCCTCCATTATACAAGGAGTTGTTCACTTCAGAATTTGAGCCAGCAATGC

Ensembl | Human Hinterlegungsnummer

ENSG00000069667

NCBI-Hinterlegungsnummer

NM_134260

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... RORA(6095) , RORA(6095)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hongyu Li et al.
Journal of cellular physiology, 233(1), 641-650 (2017-03-24)
Low O2 pressures present in the microenvironment of epidermis control keratinocyte differentiation and epidermal barrier function through hypoxia inducible factors (HIFs) dependent gene expression. This study focuses on investigating relations of the retinoic acid receptor-related orphan receptor alpha (RORα) to
Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2
Marie R Webster et al.
Pigment cell & melanoma research, 28(2), 184-195 (2014-11-20)
We have previously shown that Wnt5A drives invasion in melanoma. We have also shown that Wnt5A promotes resistance to therapy designed to target the BRAF(V600E) mutation in melanoma. Here, we show that melanomas characterized by high levels of Wnt5A respond

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.