Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU072661

Sigma-Aldrich

MISSION® esiRNA

targeting human MLKL

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGGACACATCCCACTCCAAATGATATTTCCAAAAACATACCTCTGACAGTAACTTTGATAGATGGTTTGTCAAATGTATCTTTCTGGGTATCCACACCTCTTGGCAATGAAATTTGCAGCTCCTCCCTTCCATAAATGAAGTCTCTTTCCCCACCATTTGAATCTGGGCTGGCACTGTGACTTGATTTGATCAATAGAATGTGGAAGAAGTGACTGTATGCCAGTTCCAAGCCTAGGTTTCAAGAGGCCTTATAAATGTCTGTTGGAACCTTACCCAGCCATGAACATGTTGAGTGAGCATGCTGGAGAATGAGAGACCACATGAAGCAGAAACATGCTTTCCTAGCTGAAGTCATACTAGCCCAACCAACATGGCAGCTAACACATGAATGAGGCCAATCAAGACCAG

Ensembl | Human Hinterlegungsnummer

ENSG00000168404

NCBI-Hinterlegungsnummer

NM_152649

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MLKL(197259) , MLKL(197259)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Chengkui Yang et al.
Cell death & disease, 8(10), e3084-e3084 (2017-10-06)
Receptor-interacting kinase-3 (RIP3) is a key regulator of necroptosis. It has been shown that the expression of RIP3 is silenced in most cancer cells and tissues due to genomic methylation. However, the regulatory mechanisms controlling RIP3 expression in cancer cells
Piotr T Filipczak et al.
Cancer research, 76(24), 7130-7139 (2016-10-21)
Tuberous sclerosis complex (TSC) is a genetic multiorgan disorder characterized by the development of neoplastic lesions in kidney, lung, brain, heart, and skin. It is caused by an inactivating mutation in tumor suppressor genes coding the TSC1/TSC2 complex, resulting in
Yu Matsuzawa-Ishimoto et al.
The Journal of experimental medicine, 214(12), 3687-3705 (2017-11-02)
A variant of the autophagy gene
Yu Xiong et al.
Cell death and differentiation, 26(10), 1929-1941 (2019-01-16)
Necroptosis is a programmed form of necrotic cell death, which is tightly regulated by the necroptotic signaling pathway containing receptor-interacting protein (RIP)1, RIP3, and mixed-lineage kinase domain-like (MLKL) protein. In addition to the RIP1-RIP3-MLKL axis, other factors regulating necroptosis are
R S Al-Lamki et al.
Cell death & disease, 7(6), e2287-e2287 (2016-07-01)
We previously reported that renal clear cell carcinoma cells (RCC) express both tumor necrosis factor receptor (TNFR)-1 and -2, but that, in organ culture, a TNF mutein that only engages TNFR1, but not TNFR2, causes extensive cell death. Some RCC
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.