Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU068101

Sigma-Aldrich

MISSION® esiRNA

targeting human CAMK2A

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGCTTCACGGAAGAGTACCAGCTCTTCGAGGAATTGGGCAAGGGAGCCTTCTCGGTGGTGCGAAGGTGTGTGAAGGTGCTGGCTGGCCAGGAGTATGCTGCCAAGATCATCAACACAAAGAAGCTGTCAGCCAGAGACCATCAGAAGCTGGAGCGTGAAGCCCGCATCTGCCGCCTGCTGAAGCACCCCAACATCGTCCGACTACATGACAGCATCTCAGAGGAGGGACACCACTACCTGATCTTCGACCTGGTCACTGGTGGGGAACTGTTTGAAGATATCGTGGCCCGGGAGTATTACAGTGAGGCGGATGCCAGTCACTGTATCCAGCAGATCCTGGAGGCTGTGCTGCACTGCCACCAGATGGGGGTGGTGCACCGGGACCTGAAGCCTGAGAATCTGTTGCTGGCCTC

Ensembl | Human Hinterlegungsnummer

ENSG00000070808

NCBI-Hinterlegungsnummer

NM_171825

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CAMK2A(815) , CAMK2A(815)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yamin Wei et al.
Neurochemical research, 44(7), 1613-1620 (2019-03-29)
Ischemic stroke is a leading cause of mortality and morbidity worldwide, and oxidative stress plays a significant role in the ischemia stage and reperfusion stage. Previous studies have indicated that both calcium/calmodulin-dependent protein kinase II (CaMKII) and glucose 6-phosphate dehydrogenase
Wenwei Liang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 42(1), 383-396 (2017-05-31)
Periodic mechanical stress can promote chondrocyte proliferation and matrix synthesis to improve the quality of tissue-engineered cartilage. Although the integrin β1-ERK1/2 signal cascade has been implicated in periodic mechanical stress-induced mitogenic effects in chondrocytes, the precise mechanisms have not been
Tae-Kyung Kim et al.
Neurobiology of disease, 79, 59-69 (2015-04-29)
Physical exercise is considered beneficial in the treatment of depression, but the underlying mechanism is not clearly understood. In the present study, we investigated the mechanism regulating antidepressant effects of exercise by focusing on the role of the amygdala using
Sébastien Küry et al.
American journal of human genetics, 101(5), 768-788 (2017-11-04)
Calcium/calmodulin-dependent protein kinase II (CAMK2) is one of the first proteins shown to be essential for normal learning and synaptic plasticity in mice, but its requirement for human brain development has not yet been established. Through a multi-center collaborative study
Jie-Min Jia et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(41), 13725-13736 (2014-10-10)
Dysbindin is a schizophrenia susceptibility gene required for the development of dendritic spines. The expression of dysbindin proteins is decreased in the brains of schizophrenia patients, and neurons in mice carrying a deletion in the dysbindin gene have fewer dendritic
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.