Direkt zum Inhalt
Merck

EHU061431

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF10B

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGACCACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCCTAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTTTCTGGAAAAAGCCCAACTGGACTCCAGTCAGTAGGAAAGTGCCACAATTGTCACATGACCGGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCCTGTAACTTTTCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATGTCTGGATCATTCCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACAGCACTTTTTTATCCTAATGTAAATGCTTTATTTATTTATTTGGGCTACATTGTAAGATCCATCTACACAGTCGTTGTCCGACTTCACTTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yongqing Liu et al.
Oncology letters, 15(3), 2871-2880 (2018-02-13)
Retigeric acid B (RAB), a natural compound isolated from lichen, has been demonstrated to inhibit cell growth and promote apoptosis in prostate cancer (PCa) cells. The present study evaluated the function of RAB combined with clinical chemotherapeutic drugs in PCa
Cheng-Hung Chuang et al.
Chemico-biological interactions, 306, 54-61 (2019-04-09)
In the present study, we investigated the p53-independent mechanism by which quercetin (Q) increased apoptosis in human lung cancer H1299 cells exposed to trichostatin A (TSA), a histone deacetylase inhibitor. We also investigated the role of Q in increasing the acetylation
Mi Hee Park et al.
Biochemical and biophysical research communications, 473(2), 586-592 (2016-04-02)
We investigated whether bakuchiol, an analog of resveratrol enhances the apoptosis ability of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in cancer cells. Bakuchiol enhanced expression of cell death receptor (DR) in TRAIL-sensitive and -resistant colon cancer cells in a
Fanyun Kong et al.
Virology journal, 12, 192-192 (2015-11-19)
HBV X protein (HBX) is associated with cell apoptosis mediated by TNF-α related apoptosis inducing ligand (TRAIL), while the role of HBX on the expressions of TRAIL receptors death receptor 4 (DR4) and DR5 are unclear. In this study, we
Seon Min Woo et al.
International journal of molecular sciences, 20(13) (2019-07-05)
R428, a selective small molecule Axl inhibitor, is known to have anti-cancer effects, such as inhibition of invasion and proliferation and induction of cell death in cancer cells. The Axl receptor tyrosine kinase is highly expressed in cancer cells and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.