Direkt zum Inhalt
Merck

EHU058451

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTTGGACACCGAGGAACAGTAAGAGATTATCCAGACTTTAGCCCATCAGTGGATGCTGAAGCTATTCAGAAAGCAATCAGAGGAATTGGAACTGATGAGAAAATGCTCATCAGCATTCTGACTGAGAGGTCAAATGCACAGCGGCAGCTGATTGTTAAGGAATATCAAGCAGCATATGGAAAGGAGCTGAAAGATGACTTGAAGGGTGATCTCTCTGGCCACTTTGAGCATCTCATGGTGGCCCTAGTGACTCCACCAGCAGTCTTTGATGCAAAGCAGCTAAAGAAATCCATGAAGGGCGCGGGAACAAACGAAGATGCCTTGATTGAAATCTTAACTACCAGGACAAGCAGGCAAATGAAGGATATCTCTCAAGCCTATTATACAGTATACAAGAAGAGTCTTGGAGATGACATTAGTTCCGAAACATCTGGTGACTTCCGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

S Y Yu et al.
Neoplasma, 61(3), 257-264 (2014-05-16)
Annexin A3 participates in various biological processes, including tumorigenesis, drug resistance, and metastasis. The aim of this study was to investigate the expression of Annexin A3 in gastric cancer and its relationship with cell differentiation, migration, and invasion of gastric
Ruisi Xu et al.
Journal of cellular biochemistry, 120(9), 14585-14593 (2019-04-19)
Colorectal cancer (CRC) is a common disease with high mortality and morbidity. Annexin A3 (ANXA3) belongs to the structurally homologous family of Ca2+ and phospholipid-binding proteins. This study aimed to investigate the effects and potential mechanisms of ANXA3 on oxaliplatin
Qiu-Zhong Pan et al.
Molecular carcinogenesis, 54(8), 598-607 (2014-01-01)
Annexin A3 (ANXA3) has been found to play important roles in cancer progression, metastasis, and drug resistance; however, its role in hepatocellular carcinoma (HCC) remains unknown. In this study, we investigated the expression level, clinical significance and biologic function of
Stryder M Meadows et al.
PloS one, 10(7), e0132580-e0132580 (2015-07-17)
Annexins are a large family of calcium binding proteins that associate with cell membrane phospholipids and are involved in various cellular processes including endocytosis, exocytosis and membrane-cytoskeletal organization. Despite studies on numerous Annexin proteins, the function of Annexin A3 (Anxa3)
Min Jung Lee et al.
Metabolism: clinical and experimental, 64(9), 1134-1145 (2015-06-09)
Autophagy has emerged as a potentially important factor in the pathogenesis of atherosclerosis. Dehydroepiandrosterone (DHEA) is an adrenal steroid of great recent interest due to its anti-aging and anti-atherogenic effects; however, little is known about its role in autophagy and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.