Direkt zum Inhalt
Merck

EHU043071

Sigma-Aldrich

MISSION® esiRNA

targeting human XRN1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACATCCGAGCTTTCGACTCCCGTTTCTCCAATATCAAAACATTGGATGATTTGTTTCCTCTGAGAAGTATGGTCTTTATGCTGGGAACTCCCTATTATGGCTGCACTGGAGAAGTTCAGGATTCAGGTGATGTGATTACAGAAGGTAGGATTCGTGTGATTTTCAGCATTCCATGTGAACCCAATCTTGATGCTTTAATACAGAACCAGCATAAATATTCTATAAAGTACAACCCAGGATATGTGTTGGCCAGTCGCCTTGGAGTGAGTGGATACCTTGTTTCAAGGTTTACAGGAAGTATTTTTATTGGAAGAGGATCTAGGAGAAACCCTCATGGAGACCATAAAGCAAATGTGGGTTTAAATCTCAAATTCAACAAGAAAAATGAGGAGGTACCTGGATATACTAAGAAAGTTGGAAGTGAATGGATGTATTCATCTGCAGCAGAACAACTTCTGGCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Joséphine Zangari et al.
Nucleic acids research, 45(7), 4131-4141 (2016-12-21)
Extracellular vesicles (EVs) have been shown to play an important role in intercellular communication as carriers of DNA, RNA and proteins. While the intercellular transfer of miRNA through EVs has been extensively studied, the stability of extracellular miRNA (ex-miRNA) once
Rodney P Kincaid et al.
Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8197-8202 (2018-07-25)
Seventy percent of people infected with hepatitis C virus (HCV) will suffer chronic infection, putting them at risk for liver disease, including hepatocellular carcinoma. The full range of mechanisms that render some people more susceptible to chronic infection and liver
Shin-Ichiro Hori et al.
Biochemical and biophysical research communications, 464(2), 506-511 (2015-07-15)
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood.
Oussama Meziane et al.
Scientific reports, 5, 16688-16688 (2015-11-21)
The decapping scavenger enzyme DcpS is known for its role in hydrolyzing the cap structure following mRNA degradation. Recently, we discovered a new function in miRNA degradation activation for the ortholog of DcpS in C. elegans. Here we show that

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.