Direkt zum Inhalt
Merck

EHU040951

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSD, RP11-295K3.1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tung-Yi Lin et al.
International journal of molecular sciences, 21(17) (2020-08-28)
Poor prognosis due to the high relapse and metastasis rates of breast cancer has been particularly linked to the luminal B subtype. The current study utilized MCF-7 and ZR-75-1 to investigate various luminal subtypes of breast cancers that have discrepant
Satoshi Kitazawa et al.
Cancer science, 108(6), 1185-1193 (2017-03-21)
Vacuolar (H
C S F Oliveira et al.
Cell death & disease, 6, e1788-e1788 (2015-06-19)
Acetate is a short-chain fatty acid secreted by Propionibacteria from the human intestine, known to induce mitochondrial apoptotic death in colorectal cancer (CRC) cells. We previously established that acetate also induces lysosome membrane permeabilization in CRC cells, associated with release
Lin Cui et al.
Frontiers in cell and developmental biology, 8, 31-31 (2020-03-03)
Lysosomal membrane permeabilization (LMP) has recently been recognized as an important cell death pathway in various cell types. However, studies regarding the correlation between LMP and cardiomyocyte death are scarce. Lysosomal membrane-associated protein 2 (Lamp2) is an important component of
Morten P Oksvold et al.
Clinical therapeutics, 36(6), 847-862 (2014-06-24)
Exosomes are small (30- to 100-nm) vesicles secreted by all cell types in culture and found in most body fluids. A mean of 1 mL of blood serum, derived from healthy donors, contains approximately 10(12) exosomes. Depending on the disease

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.