Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU037081

Sigma-Aldrich

MISSION® esiRNA

targeting human HAVCR2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGGAGGAGCCCAATGAGTATTATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATGCCATAGATCCAACCACCTTATTTTTGAGCTTGGTGTTTTGTCTTTTTCAGAAACTATGAGCTGTGTCACCTGACTGGTTTTGGAGGTTCTGTCCACTGCTATGGAGCAGAGTTTTCCCATTTTCAGAAGATAATGACTCACATGGGAATTGAACTGGGACCTGCACTGAACTTAAACAGGCATGTCATTGCCTCTGTATTTAAGCCAACAGAGTTACCCAACCCAGAGACTGTTAATCATGGATGTTAGAGCTCAAACGGGCTTTTATATACACTAGGAATTCTTGACGTGGGGTCTCTGGAGCTCCAGGAAATTCGGGCACATCATA

Ensembl | Human Hinterlegungsnummer

ENSG00000135077

NCBI-Hinterlegungsnummer

NM_032782

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... HAVCR2(84868) , HAVCR2(84868)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Cecilia Fernandez-Ponce et al.
PloS one, 9(1), e85191-e85191 (2014-01-28)
Adaptive T cell responses are critical for controlling HCV infection. While there is clinical evidence of a relevant role for regulatory T cells in chronic HCV-infected patients, based on their increased number and function; mechanisms underlying such a phenomena are
Huapeng Lin et al.
Oncology letters, 14(5), 5899-5905 (2017-11-09)
T-cell immunoglobulin mucin (TIM)-3 is an important member of the TIM gene family, which was thought to contribute to the progression of numerous types of cancer, including hepatocellular carcinoma (HCC); however, the mechanism underlying TIM-3 functions in HCC progression has
Rong-Ti Ge et al.
Immunologic research, 64(2), 470-475 (2015-09-26)
The T helper 1 (Th1) polarization plays a critical role in the pathogenesis of a number of inflammatory disorders in the body; the remedies in the correction of polarized Th1 cells are limited. This study aims to investigate the role
Yong-Rui Piao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(11), 11409-11414 (2014-08-15)
T cell immunoglobulin domain and mucin domain-containing molecule 3 (Tim-3) is a newly discovered immunomodulatory, which plays an important role in immunity regulation. Recent evidence suggests that Tim-3 is differentially regulated in a variety of tumors and has a potential
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.