Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU035971

Sigma-Aldrich

MISSION® esiRNA

targeting human MARCKS

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGAACTACACTTGGGCTCCTTTTTTTGTGCTCGACTTTTCCACCCTTTTTCCCTCCCTCCTGTGCTGCTGCTTTTTGATCTCTTCGACTAAAATTTTTTTATCCGGAGTGTATTTAATCGGTTCTGTTCTGTCCTCTCCACCACCCCCACCCCCCTCCCTCCGGTGTGTGTGCCGCTGCCGCTGTTGCCGCCGCCGCTGCTGCTGCTCGCCCCGTCGTTACACCAACCCGAGGCTCTTTGTTTCCCCTCTTGGATCTGTTGAGTTTCTTTGTTGAAGAAGCCAGCATGGGTGCCCAGTTCTCCAAGACCGCAGCGAAGGGAGAAGCCGCCGCGGAGAGGCCTGGGGAGGCGGCTGTGGCCTCGTCGCCTTCCAAAGCGAACGGACAGGAGAATGGCCACGTGAAGGTAAA

Ensembl | Human Hinterlegungsnummer

ENSG00000155130

NCBI-Hinterlegungsnummer

NM_002356

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MARCKS(4082) , MARCKS(4082)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Cuong Van Dao et al.
The Journal of veterinary medical science, 79(12), 1931-1938 (2017-10-20)
Methylmercury (MeHg) is an environmental pollutant that shows severe toxicity to humans and animals. However, the molecular mechanisms mediating MeHg toxicity are not completely understood. We have previously reported that the MARCKS protein is involved in the MeHg toxicity to
Jun Li et al.
Journal of Cancer, 10(11), 2480-2487 (2019-07-02)
Objective: Recently, accumulating evidence has indicated that the 3' untranslated regions (3'UTRs) of protein coding genes play critical roles in the progression of various cancers, including ovarian cancer. This study is aimed to identify the potential role of SNAI2-3'UTR in
Ching-Hsien Chen et al.
Oncotarget, 6(17), 15194-15208 (2015-05-28)
Accumulating evidence has suggested that myristoylated alanine-rich C-kinase substrate (MARCKS) is critical for regulating multiple pathophysiological processes. However, the molecular mechanism underlying increased phosphorylation of MARCKS at Ser159/163 (phospho-MARCKS) and its functional consequence in neoplastic disease remain to be established.
C-H Chen et al.
Oncogene, 33(28), 3696-3706 (2013-08-21)
Myristoylated Alanine-Rich C Kinase Substrate (MARCKS), a substrate of protein kinase C, is a key regulatory molecule controlling mucus granule secretion by airway epithelial cells as well as directed migration of leukocytes, stem cells and fibroblasts. Phosphorylation of MARKCS may
Dan Yu et al.
Journal of the American Heart Association, 4(10), e002255-e002255 (2015-10-10)
Transcription of the myristoylated alanine-rich C kinase substrate (MARCKS) is upregulated in animal models of intimal hyperplasia. MARCKS knockdown inhibits vascular smooth muscle cell (VSMC) migration in vitro; however, the mechanism is as yet unknown. We sought to elucidate the

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.