Direkt zum Inhalt
Merck

EHU034121

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKCG

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAAAGGACGTGATCGTCCAGGACGACGATGTGGACTGCACGCTGGTGGAGAAACGTGTGCTGGCGCTGGGGGGCCGGGGTCCTGGCGGCCGGCCCCACTTCCTCACCCAGCTCCACTCCACCTTCCAGACCCCGGACCGCCTGTATTTCGTGATGGAGTACGTCACCGGGGGAGACTTGATGTACCACATTCAACAGCTGGGCAAGTTTAAGGAGCCCCATGCAGCGTTCTACGCGGCAGAAATCGCTATCGGCCTCTTCTTCCTTCACAATCAGGGCATCATCTACAGGGACCTGAAGCTGGACAATGTGATGCTGGATGCTGAGGGACACATCAAGATCACTGACTTTGGCATGTGTAAGGAGAACGTCTTCCCCGGGACGACAACCCGCACCTTCTGCGGGACCCCGGACTACATAGCCCCGGAGATCATTGCCTACCAGCCCTATGGGAAGTCTGTCGATTGGTGGTCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sylvain Carras et al.
Journal of leukocyte biology, 99(2), 311-319 (2015-09-04)
M-CSF and G-CSF are instructive cytokines that specifically induce differentiation of bipotent myeloid progenitors into macrophages and granulocytes, respectively. Through morphology and colony assay studies, flow cytometry analysis of specific markers, and expression of myeloid transcription factors, we show here
Juan Carlos Montero et al.
Oncotarget, 7(47), 77937-77949 (2016-10-28)
P-Rex proteins are guanine nucleotide exchange factors (GEFs) that act on the Rho/Rac family of GTP binding proteins. The activity of P-Rex proteins is regulated by several extracellular stimuli. In fact, activation of growth factor receptors has been reported to
Tianchao Yu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 395-402 (2016-09-27)
Application of general anesthetics may induce neurotoxicity in dorsal root ganglia (DRG) neurons. In this study, we examined the possible protective mechanism and associated signaling pathways of small-molecule glycogen synthase kinase-3 (GSK-3) inhibitor, SB216763, in bupivacaine-injured mouse DRG neurons in
Yoon Kyung Choi
Archives of pharmacal research, 40(12), 1433-1442 (2017-10-13)
Treatment of human retinal microvascular endothelial cells (HRMECs) with vascular endothelial growth factor 165 (VEGF
Feng Chen et al.
PloS one, 9(7), e99823-e99823 (2014-07-16)
Gram positive (G+) infections make up ∼50% of all acute lung injury cases which are characterized by extensive permeability edema secondary to disruption of endothelial cell (EC) barrier integrity. A primary cause of increased permeability are cholesterol-dependent cytolysins (CDCs) of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.