Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU033391

Sigma-Aldrich

MISSION® esiRNA

targeting human MGMT

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGGCTGAATGCCTATTTCCACCAGCCCGAGGCTATCGAAGAGTTCCCCGTGCCGGCTCTTCACCATCCCGTTTTCCAGCAAGAGTCGTTCACCAGACAGGTGTTATGGAAGCTGCTGAAGGTTGTGAAATTCGGAGAAGTGATTTCTTACCAGCAATTAGCAGCCCTGGCAGGCAACCCCAAAGCCGCGCGAGCAGTGGGAGGAGCAATGAGAGGCAATCCTGTCCCCATCCTCATCCCGTGCCACAGAGTGGTCTGCAGCAGCGGAGCCGTGGGCAACTACTCCGGAGGACTGGCCGTGAAGGAATGGCTTCTGGCCCATGAAGGCCACCGGTTGGGGAAGCCAGGCTTGGGAGGGAGCTCAGGTCTGGCAGGGGCCTGGCTCAAGGGAGCGGGAGCTACCTCGGGCTCCCCGCCTGCTGGCCGAAACTGAGTATGTGCAGTAGGATGGATGTTTGAGCGACACACACGTGTA

Ensembl | Human Hinterlegungsnummer

ENSG00000170430

NCBI-Hinterlegungsnummer

NM_002412

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MGMT(4255) , MGMT(4255)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Thatchawan Thanasupawat et al.
Molecular oncology, 11(8), 1078-1098 (2017-05-14)
The multikinase inhibitor and FDA-approved drug dovitinib (Dov) crosses the blood-brain barrier and was recently used as single drug application in clinical trials for GB patients with recurrent disease. The Dov-mediated molecular mechanisms in GB cells are unknown. We used
Jin Cheng et al.
Toxicology, 389, 67-73 (2017-07-20)
N-methyl-2,2-di(chloroethyl)amine (HN2) is a kind of bifunctional alkyltating agent, which can react with nucleophilic groups in DNA and/or protein to form HN2-bridged crosslinking of target molecules, such as DNA-protein crosslinkings (DPC). O
Xinwei Li et al.
Pathology oncology research : POR, 26(2), 707-714 (2019-02-04)
Primary central nervous system lymphoma (PCNSL) is an aggressive and rare subtype of non-Hodgkin lymphoma, arising exclusively in the CNS with a poor prognosis. Previous evidence has proved that MGMT was a promising target involving in TMZ resistance of PCNSL.
Lucio Tentori et al.
BMC cancer, 14, 151-151 (2014-03-07)
Chemoresistance of glioblastoma multiforme (GBM) has been attributed to the presence within the tumor of cancer stem cells (GSCs). The standard therapy for GBM consists of surgery followed by radiotherapy and the chemotherapeutic agent temozolomide (TMZ). However, TMZ efficacy is
Boswellic acid has anti-inflammatory effects and enhances the anticancer activities of Temozolomide and Afatinib, an irreversible ErbB family blocker, in human glioblastoma cells.
Manlio Barbarisi et al.
Phytotherapy research : PTR, 33(6), 1670-1682 (2019-03-30)
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.