Direkt zum Inhalt
Merck

EHU024601

Sigma-Aldrich

MISSION® esiRNA

targeting human MTDH

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCACAGTTACCACCGAGCAACTTACAACCGCATCATTTCCTGTTGGTTCCAAGAAGAATAAAGGTGATTCTCATCTAAATGTTCAAGTTAGCAACTTTAAATCTGGAAAAGGAGATTCTACACTTCAGGTTTCTTCAGGATTGAATGAAAACCTCACTGTCAATGGAGGAGGCTGGAATGAAAAGTCTGTAAAACTCTCCTCACAGATCAGTGCAGGTGAGGAGAAGTGGAACTCCGTTTCACCTGCTTCTGCAGGAAAGAGGAAAACTGAGCCATCTGCCTGGAGTCAAGACACTGGAGATGCTAATACAAATGGAAAAGACTGGGGAAGGAGTTGGAGTGACCGTTCAATATTTTCTGGCATTGGGTCTACTGCTGAGCCAGTTTCTCAGTCTACCACTTCTGATTATCAGTGGGATGTTAGCCGTAATCAACCCTATATCGATGATGAATGGTCTGGGTTAAATGGTCTGTCTTCTGCTGATCCCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rongquan He et al.
American journal of translational research, 9(4), 1561-1579 (2017-05-05)
Recent studies found that metadherin (MTDH) played an essential role in hepatocellular carcinoma (HCC). Nevertheless, the exact function of MTDH in the pathogenesis of HCC was unclarified. In the present study, we aimed to investigate the clinical significance of MTDH
Yongfeng Zhang et al.
Molecular medicine reports, 18(3), 3099-3105 (2018-07-18)
MicroRNAs (miRNAs/miRs) serve important roles in regulating gene expression by directly binding to the 3'‑untranslated regions of target genes. Multiple miRNAs are dysregulated in retinoblastoma (RB) and their dysregulation is closely related to RB malignancy. Therefore, exploring the detailed roles
Dong Pan et al.
International journal of oncology, 54(6), 1955-1968 (2019-05-14)
Studies have rarely been conducted on the role of miRNAs in prostate cancer (PCa) cell progression by directly targeting MTDH, at least to the best of our knowledge. Thus, the present study aimed to identify miRNAs closely related with metadherin
Fan Yang et al.
OncoTargets and therapy, 12, 4415-4426 (2019-06-27)
Purpose: Several microRNAs (miRNAs) that are aberrantly expressed in glioblastoma multiforme (GBM) play a significant role in GBM formation and progression. The expression profile and functions of miR-559 in GBM remain unclear. Here, we quantified the expression and investigated the
Kensuke Suzuki et al.
Oncotarget, 8(39), 66098-66111 (2017-10-17)
Pancreatic ductal adenocarcinoma (PDAC) has a high metastatic potential. However, the mechanism of metastatic colonization in PDAC remains poorly understood. Metadherin (MTDH) has emerged in recent years as a crucial mediator of metastasis in several cancer types, although the biological

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.