Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU022821

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTC

Ensembl | Human Hinterlegungsnummer

ENSG00000121966

NCBI-Hinterlegungsnummer

NM_001008540

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CXCR4(7852) , CXCR4(7852)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Chunming Jiang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(6), 2250-2260 (2018-05-08)
Osteosarcoma, the most common primary bone malignancy, arises from primitive transformed cells of mesenchymal origin with the worldwide increasing morbidity and mortality. Previous studies found apoptosis of osteosarcoma cells was essential for an effective manner to improve the progress of
Younghun Jung et al.
Cancer research, 78(8), 2026-2039 (2018-02-13)
There is evidence that cancer stem-like cells (CSC) and neuroendocrine behavior play critical roles in the pathogenesis and clinical course of metastatic castration-resistant prostate cancer (m-CRPC). However, there is limited mechanistic understanding of how CSC and neuroendocrine phenotypes impact the
Lei Li et al.
Biochimica et biophysica acta. General subjects, 1862(8), 1790-1800 (2018-05-08)
HIV infection and/or the direct pathogenic effects of circulating HIV proteins impairs the physiological function of mesenchymal stem cells (MSCs), and contribute to the pathogenesis of age-related clinical comorbidities in people living with HIV. The SDF-1/CXCR4 pathway is vital for
Jong-Ik Heo et al.
Cells, 8(10) (2019-10-30)
Stromal cell-derived factor 1 (SDF-1) and its main receptor, CXC chemokine receptor 4 (CXCR4), play a critical role in endothelial cell function regulation during cardiogenesis, angiogenesis, and reendothelialization after injury. The expression of CXCR4 and SDF-1 in brain endothelial cells
Nahyeon Kang et al.
BMC cancer, 19(1), 148-148 (2019-02-15)
A hypoxic microenvironment leads to an increase in the invasiveness and the metastatic potential of cancer cells within tumors via the epithelial-mesenchymal transition (EMT) and cancer stemness acquisition. However, hypoxia-induced changes in the expression and function of candidate stem cell
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.