Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

View All Documentation

EHU019041

Sigma-Aldrich

MISSION® esiRNA

targeting human STK11

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAGGAGGTTACGGCACAAAAATGTCATCCAGCTGGTGGATGTGTTATACAACGAAGAGAAGCAGAAAATATATCCTTTCCGCCCTTACTGCGTGTGTGGCATGCAGGAAATGCTGGACAGCGTGCCGGAGAAGCGTTTCCCAGTGTGCCAGGCCCACGGGTACTTCTGTCAGCTGATTGACGGCCTGGAGTACCTGCATAGCCAGGGCATTGTGCACAAGGACATCAAGCCGGGGAACCTGCTGCTCACCACCGGTGGCACCCTCAAAATCTCCGACCTGGGCGTGGCCGAGGCACTGCACCCGTTCGCGGCGGACGACACCTGCCGGACCAGCCAGGGCTCCCCGGCTTTCCAGCCGCCCGAGATTGCCAACGGCCTGGACACCTTCTCCGGCTTCAAGGTGGACATCTGGTCGGCTGGGGTCACCCTCTACAACATCACCACGGGTCTGTACCCCTTCGAAGGGGACAACATCTACAAGTTGTTTGAGAACATCGGGAAGG

Ensembl | Human Hinterlegungsnummer

ENSG00000118046

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... STK11(6794) , STK11(6794)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Qing Ma et al.
Oncology letters, 16(1), 1291-1297 (2018-07-03)
Liver kinase B1 (LKB1) encodes a serine/threonine kinase and functions as a tumor suppressor. LKB1 loss-of-function somatic mutations are frequently observed in sporadic types of cancer, particularly in lung cancer. Ectopic LKB1 induces growth arrest by upregulating p21/cyclin dependent kinase
Taiyuan Li et al.
Biochemical and biophysical research communications, 482(4), 1037-1041 (2016-12-03)
Partitioning defective 3-like protein (Par3L) is a recently identified cell polarity protein that plays an important role in mammary stem cell maintenance. Previously, we showed that high expression of Par3L is associated with poor survival in malignant colorectal cancer (CRC)
Youn Ju Lee et al.
PloS one, 14(1), e0211415-e0211415 (2019-01-30)
Alcoholic liver disease (ALD) is a worldwide health problem and hepatocyte apoptosis has been associated with the development/progression of ALD. However, no definite effective pharmacotherapy for ALD is currently available. Cilostazol, a selective type III phosphodiesterase inhibitor has been shown
Shalini V Rao et al.
BMC cancer, 17(1), 68-68 (2017-01-23)
The peptide hormone gastrin exerts a growth-promoting effect in both normal and malignant gastrointestinal tissue. Gastrin mediates its effect via the cholecystokinin 2 receptor (CCKBR/CCK2R). Although a substantial part of the gastric adenocarcinomas express gastrin and CCKBR, the role of
Jacob M Kaufman et al.
Cancer research, 77(1), 153-163 (2016-11-09)
LKB1 is a commonly mutated tumor suppressor in non-small cell lung cancer that exerts complex effects on signal transduction and transcriptional regulation. To better understand the downstream impact of loss of functional LKB1, we developed a transcriptional fingerprint assay representing
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.