Direkt zum Inhalt
Merck

EHU017981

Sigma-Aldrich

MISSION® esiRNA

targeting human GPNMB

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTGCAGAAATGAGGCTGGTTTATCTGCTGATCCGTATGTTTACAACTGGACAGCATGGTCAGAGGACAGTGACGGGGAAAATGGCACCGGCCAAAGCCATCATAACGTCTTCCCTGATGGGAAACCTTTTCCTCACCACCCCGGATGGAGAAGATGGAATTTCATCTACGTCTTCCACACACTTGGTCAGTATTTCCAGAAATTGGGACGATGTTCAGTGAGAGTTTCTGTGAACACAGCCAATGTGACACTTGGGCCTCAACTCATGGAAGTGACTGTCTACAGAAGACATGGACGGGCATATGTTCCCATCGCACAAGTGAAAGATGTGTACGTGGTAACAGATCAGATTCCTGTGTTTGTGACTATGTTCCAGAAGAACGATCGAAATTCATCCGACGAAACCTTCCTCAAAGATCTCCCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rui Jin et al.
Oncology reports, 39(6), 3034-3040 (2018-04-06)
Glycoprotein non‑metastatic melanoma protein B (GPNMB) is a glycoprotein that is highly expressed in various types of cancer, including osteosarcoma. However, its cellular functions and related mechanisms in osteosarcoma remain unclear. In the present study, a higher GPNMB mRNA level was
Feifei Ren et al.
Journal of cellular physiology, 235(3), 2738-2752 (2019-09-10)
Gastric cancer has the fifth highest incidence of disease and is the third leading cause of cancer-associated mortality in the world. The etiology of gastric cancer is complex and needs to be fully elucidated. Thus, it is necessary to explore
Basilio Smuczek et al.
Experimental cell research, 358(2), 323-334 (2017-07-10)
Breast cancer is an important public health problem, and its progression may be related to the extracellular matrix (ECM), which acts as a structural scaffold and instruction source for neoplastic cells. Laminins are ECM proteins regulating tumor biology. The laminin-derived
Kotaro Kumagai et al.
PloS one, 10(11), e0143413-e0143413 (2015-11-26)
Glycoprotein nonmetastatic melanoma B (Gpnmb), a transmembrane glycoprotein that is expressed in macrophages, negatively regulates inflammation. We have reported that Gpnmb is strongly expressed in the livers of rats fed a choline-deficient, L-amino acid-defined (CDAA) diet. However, the role of
Yu-Liang Wang et al.
International journal of clinical and experimental pathology, 8(6), 6498-6504 (2015-08-12)
Glycoprotein (transmembrane) nonmetastatic melanoma protein b (GPNMB) plays crucial roles in odontogenesis. However, the role of GPNMB in human dental pulp cells (hDPCs) is still unclear. Therefore, in this study, we investigated the expression and function of the GPNMB in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.