Direkt zum Inhalt
Merck

EHU009241

Sigma-Aldrich

MISSION® esiRNA

targeting human ITGB6 (2)

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAAACTAGCAGGCATCGTCATTCCTAATGACGGGCTCTGTCACTTGGACAGCAAGAATGAATACTCCATGTCAACTGTCTTGGAATATCCAACAATTGGACAACTCATTGATAAACTGGTACAAAACAACGTGTTATTGATCTTCGCTGTAACCCAAGAACAAGTTCATTTATATGAGAATTACGCAAAACTTATTCCTGGAGCTACAGTAGGTCTACTTCAGAAGGACTCCGGAAACATTCTCCAGCTGATCATCTCAGCTTATGAAGAACTGCGGTCTGAGGTGGAACTGGAAGTATTAGGAGACACTGAAGGACTCAACTTGTCATTTACAGCCATCTGTAACAACGGTACCCTCTTCCAACACCAAAAGAAATGCTCTCACATGAAAGTGGGAGACACAGCTTCCTTCAGCGTGACTGTGAATATCCCACACTGCGAGAGAAGAAGCAGGCACATTATCATAAAGCCTGTGGGGCTGGGGGATGCCCTGGAATTACTTGTCAGCCCAGAATGCAACTGCGACTGTCAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Robert J Slack et al.
Pharmacology, 97(3-4), 114-125 (2016-01-07)
A20FMDV2 is a peptide derived from the foot-and-mouth disease virus with a high affinity and selectivity for the alpha-v beta-6 (αvβ6) arginyl-glycinyl-aspartic acid (RGD)-binding integrin. It has been shown to be an informative tool ligand in pre-clinical imaging studies for
Jiarui Bi et al.
Cytokine, 114, 135-142 (2018-11-24)
Epithelial αvβ6 integrin participates in immune surveillance in many organs, including the gastrointestinal track. Expression of αvβ6 integrin is reduced in the junctional epithelium of the gingiva in periodontal diseases, and mutations in the ITGB6 gene are associated with these
Runhong Han et al.
JCI insight, 4(7) (2019-04-05)
Chronic tubulointerstitial injury impacts the prognosis of focal segmental glomerulosclerosis (FSGS). We found that the level of versican V1 was increased in tubular cells of FSGS patients. Tubular cell-derived versican V1 induced proliferation and collagen synthesis by activating the CD44/Smad3
Jiarui Bi et al.
Scientific reports, 7(1), 4411-4411 (2017-07-02)
Periodontal diseases manifest by the formation of deep pockets between the gingiva and teeth where multispecies bacterial biofilms flourish, causing inflammation and bone loss. Epithelial cell receptor αvβ6 integrin that regulates inflammation by activating the anti-inflammatory cytokine transforming growth factor-β1

Protokolle

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.