Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

View All Documentation

EHU008861

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF10A

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACAGCAATGGGAACATAGCCCTTTGGGAGAGTTGTGTCCACCAGGATCTCATAGATCAGAACATCCTGGAGCCTGTAACCGGTGCACAGAGGGTGTGGGTTACACCAATGCTTCCAACAATTTGTTTGCTTGCCTCCCATGTACAGCTTGTAAATCAGATGAAGAAGAGAGAAGTCCCTGCACCACGACCAGGAACACAGCATGTCAGTGCAAACCAGGAACTTTCCGGAATGACAATTCTGCTGAGATGTGCCGGAAGTGCAGCAGAGGGTGCCCCAGAGGGATGGTCAAGGTCAAGGATTGTACGCCCTGGAGTGACATCGAGTGTGTCCACAAAGAATCAGGCAATGGACATAATATATGGGTGATTTTGGTTGTGACTTTGGTTGTTCCGTTGCTGTTGGTGGCTGTGCTGATTGTCTGTTGTTGCATCGGCTCAGGTTGTGGAGGGGACCCCAAGTGCATGGACAGGGTGTGTTTCTGGCGCTTGGGTCTCCTACGAGGGCCTGGGGCTGAGGACAATGCTCACAA

Ensembl | Human Hinterlegungsnummer

ENSG00000104689

NCBI-Hinterlegungsnummer

NM_003844

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TNFRSF10A(8797) , TNFRSF10A(8797)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yitong Yang et al.
The international journal of biochemistry & cell biology, 97, 62-72 (2018-02-13)
Persistent infection with hepatitis B virus (HBV) may lead to HBV-associated glomerulonephritis (HBV-GN). Presence of HBV-DNA and -RNA in renal tubular epithelial cells (RTECs) suggests direct virus-induced injury. Increase in proinflammatory cytokines is also observed under these conditions. Apoptosis by
Yuyou Deng et al.
International journal of biological sciences, 15(3), 688-700 (2019-02-13)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is an effective chemotherapeutic agent that specifically impairs cancer cells while sparing normal cells; however, some cancer cells develop resistance to TRAIL. Here, we identified Andrographolide, a diterpenoid lactone derived from a traditional herbal
Bo Ram Kim et al.
Oncogene, 38(20), 3903-3918 (2019-01-30)
RUNX3 is frequently inactivated by DNA hypermethylation in numerous cancers. Here, we show that RUNX3 has an important role in modulating apoptosis in immediate response to tumor necrosis factor-related apoptosis-including ligand (TRAIL). Importantly, no combined effect of TRAIL and RUNX3
Jae Young Jang et al.
PloS one, 9(6), e98171-e98171 (2014-06-14)
Hepatitis C virus (HCV) infection causes chronic liver diseases leading to hepatocellular carcinoma (HCC) and liver failure. We have previously shown that HCV sensitizes hepatocytes to mitochondrial apoptosis via the TRAIL death receptors DR4 and DR5. Although TRAIL and its
Mamoru Akita et al.
International journal of oncology, 45(5), 1901-1912 (2014-09-02)
Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising candidate for cancer treatment, but some cancer cell types are resistant to TRAIL cytotoxicity. Therefore, overcoming this resistance is necessary for effective TRAIL therapy. Mitochondrial morphology is important for the maintenance

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.