Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

Weitere Dokumente

EHU002271

Sigma-Aldrich

MISSION® esiRNA

targeting human LEF1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAGATGGAGGCCTCTACAACAAGGGACCCTCCTACTCGAGTTATTCCGGGTACATAATGATGCCAAATATGAATAACGACCCATACATGTCAAATGGATCTCTTTCTCCACCCATCCCGAGAACATCAAATAAAGTGCCCGTGGTGCAGCCATCCCATGCGGTCCATCCTCTCACCCCCCTCATCACTTACAGTGACGAGCACTTTTCTCCAGGATCACACCCGTCACACATCCCATCAGATGTCAACTCCAAACAAGGCATGTCCAGACATCCTCCAGCTCCTGATATCCCTACTTTTTATCCCTTGTCTCCGGGTGGTGTTGGACAGATCACCCCACCTCTTGGCTGGCAAGGTCAGCCTGTATATCCCATCACGGGTGGATTCAGGCAACCCTACCCATCCTCACTGTCAGTCGACACTTCCATGTCCAGGTTTTCCCATCATATGATTCCCGGTCCTCCTGGTCCCCACACAACTGGCATCCCTCATCCAGCTATTGTAACACCTCAGGTCAAACAGGAACATCCCCACACTGACAGTGACCTAATGCACGTGAAGCCTCA

Ensembl | Human Hinterlegungsnummer

ENSG00000138795

NCBI-Hinterlegungsnummer

NM_016269

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LEF1(51176) , LEF1(51176)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rhys G Morgan et al.
Haematologica, 104(7), 1365-1377 (2019-01-12)
Canonical Wnt/β-catenin signaling is frequently dysregulated in myeloid leukemias and is implicated in leukemogenesis. Nuclear-localized β-catenin is indicative of active Wnt signaling and is frequently observed in acute myeloid leukemia (AML) patients; however, some patients exhibit little or no nuclear
Yaoyao Chen et al.
Stem cell reports, 1(3), 209-217 (2013-12-10)
Germline-competent embryonic stem cells (ESCs) have been derived from mice and rats using culture conditions that include an inhibitor of glycogen synthase kinase 3 (GSK3). However, rat ESCs remain susceptible to sporadic differentiation. Here, we show that unsolicited differentiation is
Julia Dräger et al.
Oncotarget, 8(2), 3259-3273 (2016-12-15)
Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children and show characteristics of skeletal muscle differentiation. The two major RMS subtypes in children are alveolar (ARMS) and embryonal RMS (ERMS). We demonstrate that approximately 50% of ARMS and
P Wu et al.
Cell death & disease, 5, e1085-e1085 (2014-03-01)
Inhibitor-of-apoptosis protein (IAP) inhibitors have been reported to synergistically reduce cell viability in combination with a variety of chemotherapeutic drugs via targeted cellular IAP (cIAP) depletion. Here, we found that cIAP silencing sensitised colorectal cancer (CRC) cells to selenite-induced apoptosis.
Xinyu Wang et al.
Journal of Cancer, 11(10), 3072-3081 (2020-04-01)
Background: Our previous studies reported that lymphoid enhancer-binding factor 1 (LEF1) was upregulated in esophageal squamous cell carcinoma (ESCC) and the positive expression of LEF1 was correlated with aberrant clinicopathological characteristics in ESCC patients. However, the upstream mechanism of regulating
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.