Skip to Content
Merck
All Photos(1)

Key Documents

EHU068101

Sigma-Aldrich

MISSION® esiRNA

targeting human CAMK2A

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGCTTCACGGAAGAGTACCAGCTCTTCGAGGAATTGGGCAAGGGAGCCTTCTCGGTGGTGCGAAGGTGTGTGAAGGTGCTGGCTGGCCAGGAGTATGCTGCCAAGATCATCAACACAAAGAAGCTGTCAGCCAGAGACCATCAGAAGCTGGAGCGTGAAGCCCGCATCTGCCGCCTGCTGAAGCACCCCAACATCGTCCGACTACATGACAGCATCTCAGAGGAGGGACACCACTACCTGATCTTCGACCTGGTCACTGGTGGGGAACTGTTTGAAGATATCGTGGCCCGGGAGTATTACAGTGAGGCGGATGCCAGTCACTGTATCCAGCAGATCCTGGAGGCTGTGCTGCACTGCCACCAGATGGGGGTGGTGCACCGGGACCTGAAGCCTGAGAATCTGTTGCTGGCCTC

Ensembl | human accession no.

ENSG00000070808

NCBI accession no.

NM_171825

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CAMK2A(815) , CAMK2A(815)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yamin Wei et al.
Neurochemical research, 44(7), 1613-1620 (2019-03-29)
Ischemic stroke is a leading cause of mortality and morbidity worldwide, and oxidative stress plays a significant role in the ischemia stage and reperfusion stage. Previous studies have indicated that both calcium/calmodulin-dependent protein kinase II (CaMKII) and glucose 6-phosphate dehydrogenase
Wenwei Liang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 42(1), 383-396 (2017-05-31)
Periodic mechanical stress can promote chondrocyte proliferation and matrix synthesis to improve the quality of tissue-engineered cartilage. Although the integrin β1-ERK1/2 signal cascade has been implicated in periodic mechanical stress-induced mitogenic effects in chondrocytes, the precise mechanisms have not been
Tae-Kyung Kim et al.
Neurobiology of disease, 79, 59-69 (2015-04-29)
Physical exercise is considered beneficial in the treatment of depression, but the underlying mechanism is not clearly understood. In the present study, we investigated the mechanism regulating antidepressant effects of exercise by focusing on the role of the amygdala using
Sébastien Küry et al.
American journal of human genetics, 101(5), 768-788 (2017-11-04)
Calcium/calmodulin-dependent protein kinase II (CAMK2) is one of the first proteins shown to be essential for normal learning and synaptic plasticity in mice, but its requirement for human brain development has not yet been established. Through a multi-center collaborative study
Jie-Min Jia et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(41), 13725-13736 (2014-10-10)
Dysbindin is a schizophrenia susceptibility gene required for the development of dendritic spines. The expression of dysbindin proteins is decreased in the brains of schizophrenia patients, and neurons in mice carrying a deletion in the dysbindin gene have fewer dendritic
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service