Skip to Content
Merck
All Photos(1)

Key Documents

EHU015291

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPM7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCATCTACCGAAGACACTCATGAAGTAGATTCCAAAGCAGCTTTAATACCGGATTGGTTACAAGATAGACCATCAAACAGAGAAATGCCATCTGAAGAAGGAACATTAAATGGTCTCACTTCTCCATTTAAGCCAGCTATGGATACAAATTACTATTATTCAGCTGTGGAAAGAAATAACTTGATGAGGTTATCACAGAGCATTCCATTTACACCTGTGCCTCCAAGAGGGGAGCCTGTCACAGTGTATCGTTTGGAAGAGAGTTCACCCAACATACTAAATAACAGCATGTCTTCTTGGTCACAACTAGGCCTCTGTGCCAAAATAGAGTTTTTAAGCAAAGAGGAGATGGGAGGAGGTTTACGAAGAGCTGTCAAAGTACAGTGTACCTGGTCAGAACATGATATCCTCAAATCAGGGCATCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiuzhi Zhang et al.
Acta biomaterialia, 63, 369-382 (2017-09-09)
Mg-based alloys, as the potential orthopaedic implant, can self-degrade to avoid second operation for its remove, and enable to promote bone repair; however, the underlying molecular mechanisms remain unclear. In the present study, we examined the effect of Mg ions
Constantin Römmelt et al.
Journal of biomedical materials research. Part B, Applied biomaterials, 107(6), 1806-1813 (2018-12-07)
The reasons for the high number of loosened metal-on-metal (MoM) hip implants are still not fully understood. Hypoxia-inducible factor 1 (HIF-1) mediated signaling pathways, which normally modulate tissue metabolism under hypoxic circumstances, could be triggered by metallic wear debris and
Yuqiang Liu et al.
Cell reports, 23(12), 3480-3491 (2018-06-21)
The TRPM7 chanzyme contributes to several biological and pathological processes in different tissues. However, its role in the CNS under physiological conditions remains unclear. Here, we show that TRPM7 knockdown in hippocampal neurons reduces structural synapse density. The synapse density
Aifen Liu et al.
Scientific reports, 8(1), 5510-5510 (2018-04-05)
Transient receptor potential melastatin 7 (TRPM7) is a membrane ion channel and kinase. TRPM7 was abundantly expressed in the kidney, and up-regulated by ischemia reperfusion (IR) injury. Our previous studies showed that cyclic helix B peptide (CHBP) improved renal IR-related
Hong-Liang Xu et al.
Neurochemistry international, 112, 197-205 (2017-07-25)
Neuronal death after traumatic brain injury (TBI) is a complex process resulting from a combination of factors, many of which are still unknown. Transient receptor potential melastatin 7 (TRPM7) is a transient receptor potential channel that has been demonstrated to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service