Skip to Content
Merck
All Photos(1)

Key Documents

EHU151881

Sigma-Aldrich

MISSION® esiRNA

targeting human SCN5A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAACGCCTTGTATGTCCTCAGTCCCTTCCACCCCATCCGGAGAGCGGCTGTGAAGATTCTGCTTTCCTTGACCCCACGCACGCTCTTCAACATGCTCATCATGTGCACCATCCTCACCAACTGCGTGTTCATGGCCCAGCACGACCCTCCACCCTGGACCAAGTATGTCGAGTACACCTTCACCGCCATTTACACCTTTGAGTCTCTGGTCAAGATTCTGGCTCGAGGCTTCTGCCTGCACGCGTTCACTTTCCTTCGGGACCCATGGAACTGGCTGGACTTTAGTGTGATTATCATGGCATACACAACTGAATTTGTGGACCTGGGCAATGTCTCAGCCTTACGCACCTTCCGAGTCCTCCGGGCCCTGAAAACTATATCAGTCATTTCAGGGCTGAAGACCATCGTGGGGGCCCTGATCCAGTCTGTGAAGAAGCTGGCTGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wan-Lin Lo et al.
Nature immunology, 13(9), 880-887 (2012-07-31)
The sustained entry of Ca(2+) into CD4(+)CD8(+) double-positive thymocytes is required for positive selection. Here we identified a voltage-gated Na(+) channel (VGSC) that was essential for positive selection of CD4(+) T cells. Pharmacological inhibition of VGSC activity inhibited the sustained
Jie Zhang et al.
Acta biochimica et biophysica Sinica, 51(6), 562-570 (2019-05-30)
The protein voltage-gated sodium channel Nav1.5 is highly upregulated in various types of cancer and, in general, promotes cancer cell invasiveness and metastatic progression. A previous study found that Nav1.5 was highly expressed in poorly differentiated oral squamous cell carcinoma
Ming Yang et al.
Journal of cellular physiology, 235(4), 3950-3972 (2019-10-16)
Ion channels can regulate the plasma membrane potential (Vm ) and cell migration as a result of altered ion flux. However, the mechanism by which Vm regulates motility remains unclear. Here, we show that the Nav 1.5 sodium channel carries

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service