Skip to Content
Merck
All Photos(1)

Key Documents

EHU149571

Sigma-Aldrich

MISSION® esiRNA

targeting human MUC4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCAGATGCGATGGCTACAAGGGCTACGACCTGGTCTACAGCCCCCAGAGCGGCTTCACCTGCGTGTCCCCGTGCAGTAGGGGCTACTGTGACCATGGAGGCCAGTGCCAGCACCTGCCCAGTGGGCCCCGCTGCAGCTGTGTGTCCTTCTCCATCTACACGGCCTGGGGCGAGCACTGTGAGCACCTGAGCATGAAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dongkui Xu et al.
Biochemical and biophysical research communications, 485(2), 556-562 (2016-12-08)
The dysregulated molecules and their involvement in lymph node metastases of cervical cancer are far from been fully revealed. In this study, by reviewing MUC4 expression in The Human Protein Atlas and retrieving gene microarray data in GEO dataset (No.
Se-Ra Lee et al.
International journal of molecular sciences, 20(11) (2019-05-31)
Tristetraprolin (TTP), a well-characterized AU-rich element (ARE) binding protein, functions as a tumor suppressor gene. The purpose of this study was to investigate whether a bioactive substance derived from a natural medicinal plant affects the induction of TTP and to
Lu-Yan Shen et al.
Oncotarget, 7(4), 4531-4541 (2015-12-18)
Heterogeneous efficacy of neoadjuvant chemotherapy has led to controversies that have limited its application in clinical practice. Thus, we aimed to identify potential biomarkers predicting esophageal squamous cell carcinoma (ESCC) chemo-responsiveness by gene expression profiling. CCK8 assay was used to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service