Skip to Content
Merck
All Photos(1)

Key Documents

EHU066521

Sigma-Aldrich

MISSION® esiRNA

targeting human SEMA4D

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTTACGTGTGTGGGACCAACGCATTCCAGCCGGCCTGTGACCACCTGAACTTAACATCCTTTAAGTTTCTGGGGAAAAATGAAGATGGCAAAGGAAGATGTCCCTTTGACCCAGCACACAGCTACACATCCGTCATGGTTGATGGAGAACTTTATTCGGGGACGTCGTATAATTTTTTGGGAAGTGAACCCATCATCTCCCGAAATTCTTCCCACAGTCCTCTGAGGACAGAATATGCAATCCCTTGGCTGAACGAGCCTAGTTTCGTGTTTGCTGACGTGATCCGAAAAAGCCCAGACAGCCCCGACGGCGAGGATGACAGGGTCTACTTCTTCTTCACGGAGGTGTCTGTGGAGTATGAGTTTGTGTTCAGGGTGCTGATCCCACGGATAGCAAGAGTGTGCAAGGGGGAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nicole Heitzig et al.
Cell adhesion & migration, 11(3), 275-287 (2017-01-07)
The physiological and pathological process of angiogenesis relies on orchestrated endothelial cell (EC) adhesion, migration and formation of new vessels. Here we report that human umbilical vein endothelial cells (HUVECs) deficient in Annexin A8 (AnxA8), a member of the annexin
Katharina Lueck et al.
Scientific reports, 7(1), 4638-4638 (2017-07-07)
The retinoic acid derivative fenretinide (FR) is capable of transdifferentiating cultured retinal pigment epithelial (RPE) cells towards a neuronal-like phenotype, but the underlying mechanisms are not understood. To identify genes involved in this process we performed a microarray analysis of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service