Skip to Content
Merck
All Photos(1)

Key Documents

EHU049241

Sigma-Aldrich

MISSION® esiRNA

targeting human GEMIN5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGGATGGCATAGTGGTGATAATTGACATCAGTAAGAAAGGAGAAGTTATTCATAGGCTTCGAGGCCATGATGATGAAATCCACTCCATAGCCTGGTGTCCCCTGCCTGGTGAAGATTGTTTATCTATAAACCAAGAGGAAACTTCAGAAGAAGCTGAAATTACCAACGGGAATGCTGTAGCACAAGCTCCAGTAACAAAAGGTTGCTACTTAGCCACTGGAAGCAAAGATCAAACCATTCGAATCTGGAGCTGTTCTAGAGGCCGAGGGGTGATGATTTTGAAATTGCCCTTTCTGAAGAGAAGAGGAGGGGGTATAGACCCAACTGTTAAAGAGCGCCTTTGGTTGACACTCCATTGGCCCAGCAATCAACCAACACAGCTGGTATCTAGCTGTTTTGGAGGTGAACTGTTGCAATGGGATCTCACTCAATCTTGGAGACGGAAATACACCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Javier Fernandez-Chamorro et al.
Nucleic acids research, 42(9), 5742-5754 (2014-03-07)
Ribonucleic acid (RNA)-binding proteins are key players of gene expression control. We have shown that Gemin5 interacts with internal ribosome entry site (IRES) elements and modulates initiation of translation. However, little is known about the RNA-binding sites of this protein.
Eileen Workman et al.
The Journal of biological chemistry, 290(25), 15662-15669 (2015-04-26)
Reduced expression of SMN causes spinal muscular atrophy, a severe neurodegenerative disease. Despite the importance of maintaining SMN levels, relatively little is known about the mechanisms by which SMN levels are regulated. We show here that Gemin5, the snRNA-binding protein

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service