Skip to Content
Merck
All Photos(1)

Key Documents

EHU134141

Sigma-Aldrich

MISSION® esiRNA

targeting human NFYA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTCATCTGGACCATCGTACTTGCTGTGGCTACTTCTAAGACAATGTAGAGGGTTATTAAACCTTGAAACTGCCTTTCCTAAGTAGAGAACAAGACTATTCAACAACTTCTTTGCTGAAGCACTGAGGAGATTTGTAATACTCCTAAAGGAAGGGCCAAACTAGAGATTTTCAATCATAGACTTTGTGACAGCATTTGGGGAACTAAAAGATTCATGTGTTTCAGCCTAGTGGGAGAGAGTGGGGGAGAGGAAGAGAGAGAGAGAGCATGTATACCCGTATGTTATCATAGAGCACGATTCTCCAGTGGATGGATACCTGGAATGGATCATTAAGATGAAGAGAGTAATTCACATTTACTCTAGAACCTTTAACAAGCACTGAAAGGAAGAAGCCTGAGATTTGATCCTTGACAATTTCTGGAAAGCACTGGTCAGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hongxin Ma et al.
Oncotarget, 6(2), 1049-1063 (2014-12-05)
We previously reported the tumor suppressor function of Zinc-fingers and homeoboxes 2 (ZHX2) in hepatocellular carcinoma (HCC). Other studies indicate the association of increased ZHX2 expression with improved response to high dose chemotherapy in multiple myeloma. Here, we aim to
Zhongcheng Shi et al.
Nucleic acids research, 43(13), 6257-6269 (2015-06-05)
Roles for SOX9 have been extensively studied in development and particular emphasis has been placed on SOX9 roles in cell lineage determination in a number of discrete tissues. Aberrant expression of SOX9 in many cancers, including colorectal cancer, suggests roles
Siyuan Ding et al.
PLoS biology, 12(1), e1001758-e1001758 (2014-01-11)
Type III interferon (IFN-λ) exhibits potent antiviral activity similar to IFN-α/β, but in contrast to the ubiquitous expression of the IFN-α/β receptor, the IFN-λ receptor is restricted to cells of epithelial origin. Despite the importance of IFN-λ in tissue-specific antiviral

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service