Skip to Content
Merck
All Photos(1)

Documents

EHU080681

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK9

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAACCTGTCAGCATTGAAGGAACTCTCACCTCCGTGGGCCTGAAATGCTTGGGAGTTGATGGAACCAAATAGAAAAACTCCATGTTCTGCATGTAAGAAACACAATGCCTTGCCCTACTCAGACCTGATAGGATTGCCTGCTTAGATGATAAAATGAGGCAGAATATGTCTGAAGAAAAAAATTGCAAGCCACACTTCTAGAGATTTTGTTCAAGATCATTTCAGGTGAGCAGTTAGAGTAGGTGAATTTGTTTCAAATTGTACTAGTGACAGTTTCTCATCATCTGTAACTGTTGAGATGTATGTGCATGTGACCACAAATGCTTGCTTGGACTTGCCCATCTAGCACTTTGGAAATCAGTATTTAAATGCCAAATAATCTTCCAGGTAGTGCTGCTTCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Leon Caly et al.
Biochemical and biophysical research communications, 483(1), 64-68 (2017-01-08)
Respiratory syncytial virus (RSV) is a major cause of respiratory infections in infants and the elderly, leading to more deaths than influenza each year worldwide. With no RSV antiviral or efficacious vaccine currently available, improved understanding of the host-RSV interaction
Takouhie Mgrditchian et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(44), E9271-E9279 (2017-10-29)
While blocking tumor growth by targeting autophagy is well established, its role on the infiltration of natural killer (NK) cells into tumors remains unknown. Here, we investigate the impact of targeting autophagy gene Beclin1 (BECN1) on the infiltration of NK
Ting Li et al.
Acta pharmacologica Sinica, 36(12), 1503-1513 (2015-11-26)
Platycodin D, the main saponin isolated from Chinese herb Platycodonis Radix, exhibits anticancer activities against various cancer cell lines. Here we evaluated its anticancer action against human hepatocellular carcinoma cells in vitro and in vivo, and elucidated the relationship between

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service