Skip to Content
Merck
All Photos(1)

Key Documents

EHU055171

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGCAGTGATCAAAAACAGAAAATTTCATTTCCCCTTCTACTACCTGTTGGCTAATTTAGCTGCTGCCGATTTCTTCGCTGGAATTGCCTATGTATTCCTGATGTTTAACACAGGCCCAGTTTCAAAAACTTTGACTGTCAACCGCTGGTTTCTCCGTCAGGGGCTTCTGGACAGTAGCTTGACTGCTTCCCTCACCAACTTGCTGGTTATCGCCGTGGAGAGGCACATGTCAATCATGAGGATGCGGGTCCATAGCAACCTGACCAAAAAGAGGGTGACACTGCTCATTTTGCTTGTCTGGGCCATCGCCATTTTTATGGGGGCGGTCCCCACACTGGGCTGGAATTGCCTCTGCAACATCTCTGCCTGCTCTTCCCTGGCCCCCATTTACAGCAGGAGTTACCTTGTTTTCTGGACAGTGTCCAACCTCATGGCCTTCCTCATCAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Protective Role for LPA
Lin Cai et al.
Frontiers in physiology, 8, 356-356 (2017-06-15)
Shuping Yang et al.
Oncotarget, 6(34), 36019-36031 (2015-10-07)
The transcriptional co-activator Yes-associated protein, YAP, is a main effector in the Hippo tumor suppressor pathway. We recently defined a mechanism for positive regulation of YAP through CDK1-mediated mitotic phosphorylation. Here, we show that active YAP promotes pancreatic cancer cell
Kai Sun et al.
Clinical and experimental medicine, 15(3), 371-380 (2014-09-12)
Triple receptor-negative breast cancers (TNBCs) generally have poor prognoses because of the loss of therapeutic targets. As lysophosphatidic acid (LPA) receptor signaling has been shown to affect breast cancer initiation and progression, we try to evaluate the potential roles of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service