Skip to Content
Merck
All Photos(1)

Key Documents

EHU156131

Sigma-Aldrich

MISSION® esiRNA

targeting human CASP4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGACAAAGTTCGGGTCATGGCAGACTCTATGCAAGAGAAGCAACGTATGGCAGGACAAATGCTTCTTCAAACCTTTTTTAACATAGACCAAATATCCCCCAATAAAAAAGCTCATCCGAATATGGAGGCTGGACCACCTGAGTCAGGAGAATCTACAGATGCCCTCAAGCTTTGTCCTCATGAAGAATTCCTGAGACTATGTAAAGAAAGAGCTGAAGAGATCTATCCAATAAAGGAGAGAAACAACCGCACACGCCTGGCTCTCATCATATGCAATACAGAGTTTGACCATCTGCCTCCGAGGAATGGAGCTGACTTTGACATCACAGGGATGAAGGAGCTACTTGAGGGTCTGGACTATAGTGTAGATGTAGAAGAGAATCTGACAGCCAGGGATATGGAGTCAGCGCTGAGGGCATTTGCTACCAGACCAGAGCACAAGTCCTCTGACAGCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chanya Srisaowakarn et al.
Infection and immunity, 88(3) (2019-12-11)
Melioidosis is an infectious disease with a high mortality rate responsible for community-acquired sepsis in Southeast Asia and Northern Australia. The causative agent of this disease is Burkholderia pseudomallei, a Gram-negative bacterium that resides in soil and contaminated natural water.
Kwong Tai Cheng et al.
The Journal of clinical investigation, 127(11), 4124-4135 (2017-10-11)
Acute lung injury is a leading cause of death in bacterial sepsis due to the wholesale destruction of the lung endothelial barrier, which results in protein-rich lung edema, influx of proinflammatory leukocytes, and intractable hypoxemia. Pyroptosis is a form of
Nicolas J Pillon et al.
American journal of physiology. Endocrinology and metabolism, 311(5), E825-E835 (2016-11-03)
Obesity is associated with metabolic tissue infiltration by monocyte-derived macrophages. Saturated fatty acids contribute to proinflammatory gene induction in tissue-embedded immune cells. However, it is unknown how circulating monocytes, the macrophage precursors, react to high-fat environments. In macrophages, saturated fatty
Qiyun Zhong et al.
PLoS biology, 18(12), e3000986-e3000986 (2020-12-31)
Clustering of the enteropathogenic Escherichia coli (EPEC) type III secretion system (T3SS) effector translocated intimin receptor (Tir) by intimin leads to actin polymerisation and pyroptotic cell death in macrophages. The effect of Tir clustering on the viability of EPEC-infected intestinal
Jeanie Quach et al.
Mucosal immunology, 12(2), 323-339 (2018-10-27)
During invasion, Entamoeba histolytica (Eh) encounter macrophages and activate them to elicit tissue damaging pro-inflammatory responses. When Eh binds macrophages via the Gal-lectin, surface EhCP-A5 RGD sequence ligates α5β1 integrin to activate caspase-1 in a complex known as the NLRP3

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service