Skip to Content
Merck
All Photos(1)

Documents

EHU093291

Sigma-Aldrich

MISSION® esiRNA

targeting human IRAK1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCTCCAGAAAGTCGAGCAGCACCCACCTCCAACCTCGGGCCAGTGTCTTCAGGCTTTACTGGGGACCTGCGAGCTGGCCTAATGTGGTGGCCTGCAAGCCAGGCCATCCCTGGGCGCCACAGACGAGCTCCGAGCCAGGTCAGGCTTCGGAGGCCACAAGCTCAGCCTCAGGCCCAGGCACTGATTGTGGCAGAGGGGCCACTACCCAAGGTCTAGCTAGGCCCAAGACCTAGTTACCCAGACAGTGAGAAGCCCCTGGAAGGCAGAAAAGTTGGGAGCATGGCAGACAGGGAAGGGAAACATTTTCAGGGAAAAGACATGTATCACATGTCTTCAGAAGCAAGTCAGGTTTCATGTAACCGAGTGTCCTCTTGCGTGTCCAAAAGTAGCCCAGGGCTGTAGCACAGGCTTCACAGTGATT

Ensembl | human accession no.

ENSG00000184216

NCBI accession no.

NM_001569

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IRAK1(3654) , IRAK1(3654)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xian Shuang Liu et al.
Molecular neurobiology, 54(1), 227-237 (2016-01-08)
Stroke induces new myelinating oligodendrocytes that are involved in ischemic brain repair. Molecular mechanisms that regulate oligodendrogenesis have not been fully investigated. MicroRNAs (miRNAs) are small non-coding RNA molecules that post-transcriptionally regulate gene expression. MiR-146a has been reported to regulate
Yan Gao et al.
Molecular medicine reports, 14(6), 5685-5692 (2016-11-24)
The present study aimed to reduce the expression of interleukin-1 receptor-associated kinase 1 (IRAK-1) in dendritic cells (DCs) by RNA interference (RNAi). Subsequently, its effects on the expression of costimulatory surface molecules, the release of inflammatory cytokines, and the proliferation of
Wei Chen et al.
OncoTargets and therapy, 13, 12787-12796 (2020-12-29)
Interleukin-1 receptor-associated kinase 1 (IRAK1) was shown to contribute to a variety of cancer-related processes. However, the function of IRAK1 in hepatocellular carcinoma (HCC) pathogenesis has not been investigated in detail. IRAK1 expression in HCC was examined by immunohistochemistry, qRT-PCR
Hong-Yi Zhang et al.
Journal of pediatric surgery, 55(11), 2308-2316 (2020-04-24)
To investigate the effects of low dose endotoxin on transcriptional activity in intestinal epithelium, and its role in necrotizing enterocolitis (NEC). Lipopolysaccharides (LPS) were injected into the amniotic cavity of pregnant mice under ultrasound guidance. The effects of LPS on
Florian Meisgen et al.
The Journal of investigative dermatology, 134(7), 1931-1940 (2014-03-29)
Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service