Skip to Content
Merck
All Photos(1)

Key Documents

EHU064111

Sigma-Aldrich

MISSION® esiRNA

targeting human ASAH1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTCAAACCAGGACTGTTCAGTCTTACACTGAATGAACGTTTCAGTATAAATGGTGGTTATCTGGGTATTCTAGAATGGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAATAGCACAAGTTATGAAGAAGCCAAGAATTTATTGACCAAGACCAAGATATTGGCCCCAGCCTACTTTATCCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGTATATGAACTCGATGCTAAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAACCATGTATGATGTCCTGTCAACAAAACCTGTCCTCAACAAGCTGACCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Su-Fern Tan et al.
Journal of lipid research, 60(6), 1078-1086 (2019-04-10)
Acute myeloid leukemia (AML) is the most common acute leukemia in adults. More than half of older AML patients fail to respond to cytotoxic chemotherapy, and most responders relapse with drug-resistant disease. Failure to achieve complete remission can be partly
Su-Fern Tan et al.
Oncotarget, 7(50), 83208-83222 (2016-11-09)
There is an urgent unmet need for new therapeutics in acute myeloid leukemia (AML) as standard therapy has not changed in the past three decades and outcome remains poor for most patients. Sphingolipid dysregulation through decreased ceramide levels and elevated
Jennifer M Pearson et al.
Molecular cancer research : MCR, 18(3), 352-363 (2019-11-21)
Acute myeloid leukemia (AML) is a disease characterized by uncontrolled proliferation of immature myeloid cells in the blood and bone marrow. The 5-year survival rate is approximately 25%, and recent therapeutic developments have yielded little survival benefit. Therefore, there is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service