Skip to Content
Merck
All Photos(1)

Key Documents

EHU054291

Sigma-Aldrich

MISSION® esiRNA

targeting human NNMT

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGGAAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCTCCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTAAGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCTGCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGACGGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTCTCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAGGAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCT

Ensembl | human accession no.

ENSG00000166741

NCBI accession no.

NM_006169

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NNMT(4837) , NNMT(4837)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yanyan Cui et al.
Molecular carcinogenesis, 59(8), 940-954 (2020-05-06)
Esophageal squamous cell carcinoma (ESCC) is a common malignant tumor with poor prognosis. And different individuals respond to the same drug differently. Increasing evidence has confirmed that metabolism reprogramming was involved in the drug sensitivity of tumor cells. However, the
Yanzhong Wang et al.
Breast cancer research : BCR, 21(1), 64-64 (2019-05-19)
Nicotinamide N-methyltransferase (NNMT) is overexpressed in various human tumors and involved in the development and progression of several carcinomas. In breast cancer, NNMT was found to be overexpressed in several cell lines. However, the clinical relevance of NNMT in breast
Yanyan Cui et al.
Molecular and cellular biochemistry, 460(1-2), 93-103 (2019-07-07)
Nicotinamide N-methyltransferase (NNMT) is an important methyltransferase involved in the biotransformation of many drugs and exogenous compounds. Abnormal expression of NNMT protein is closely associated with the onset and progression of many malignancies, but little is known about its role

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service