Skip to Content
Merck
All Photos(1)

Key Documents

EHU043671

Sigma-Aldrich

MISSION® esiRNA

targeting human SENP3, SENP3-EIF4A1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTCCCTGAAAAGGTGCATTTCTTCAATAGTTTCTTCTATGATAAACTCCGTACCGGTTATGATGGGGTGAAAAGGTGGACCAAAAACGTGGACATCTTCAATAAGGAGCTACTGCTAATCCCCATCCACCTGGAGGTGCATTGGTCCCTCATCTCTGTTGATGTGAGGCGACGCACCATCACCTATTTTGACTCGCAGCGTACCCTAAACCGCCGCTGCCCTAAGCATATTGCCAAGTATCTACAGGCAGAGGCGGTAAAGAAAGACCGACTGGATTTCCACCAGGGCTGGAAAGGTTACTTCAAAATGAATGTGGCCAGGCAGAATAATGACAGTGACTGTGGTGCTTTTGTGTTGCAGTACTGCAAGCATCTGGCCCTGTCTCAGCCATTCAGCTTCACCCAGCAGGACATGCCCAAACTTCGTCGGCAGATCTACAAGGAGCTGTGTCACTGCAAA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Y Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2778-2786 (2018-05-18)
To investigate whether SENP3 protects H9C2 cells from apoptosis triggered by H/R through the signal transducer and activator of transcription 3 (STAT3) pathway. Male C57BL mice were cultured and mouse models of myocardial I/RI were established. At the same time
Chun Guo et al.
Scientific reports, 7, 43811-43811 (2017-03-07)
The GTPase dynamin-related protein 1 (Drp1) is essential for physiological and pathophysiological mitochondrial fission. DeSUMOylation of Drp1 by the enzyme SENP3 promotes cell death during reperfusion after ischaemia by enhancing Drp1 partitioning to the mitochondrial outer membrane (MOM), which causes
Jia Luo et al.
The Journal of toxicological sciences, 42(5), 529-538 (2017-07-28)
Increased post-translational modification of proteins by SUMO-2/3 is a cytoprotective response against cell stress induced by ischaemia and reperfusion. However, it is still unclear what other cell stressors trigger protein SUMOylation, what mechanisms enhance and maintain the enhanced SUMOylation, and
Chun-Jie Huang et al.
Biochimica et biophysica acta, 1864(7), 1195-1206 (2017-03-21)
Understanding the mechanisms underlying abnormal egg production and pregnancy loss is significant for human fertility. SENP7, a SUMO poly-chain editing enzyme, has been regarded as a mitotic regulator of heterochromatin integrity and DNA repair. Herein, we report the roles of
Arnab Nayak et al.
Cell reports, 27(9), 2725-2736 (2019-05-30)
Precise assembly of the sarcomere, a force-generating unit in striated muscles, is critical for muscle contraction. Defective sarcomere organization is linked to myopathies and cachexia. The molecular mechanisms concerning sarcomere assembly are poorly understood. Here, we report that the SUMO-specific

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service