Skip to Content
Merck
All Photos(1)

Key Documents

EHU120331

Sigma-Aldrich

MISSION® esiRNA

targeting human RHOB

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCACCGTCTTCGAGAACTATGTGGCCGACATTGAGGTGGACGGCAAGCAGGTGGAGCTGGCGCTGTGGGACACGGCGGGCCAGGAGGACTACGACCGCCTGCGGCCGCTCTCCTACCCGGACACCGACGTCATTCTCATGTGCTTCTCGGTGGACAGCCCGGACTCGCTGGAGAACATCCCCGAGAAGTGGGTCCCCGAGGTGAAGCACTTCTGTCCCAATGTGCCCATCATCCTGGTGGCCAACAAAAAAGACCTGCGCAGCGACGAGCATGTCCGCACAGAGCTGGCCCGCATGAAGCAGGAACCCGTGCGCACGGATGACGGCCGCGCCATGGCCGTGCGCATCCAAGCCTACGACTACCTCGAGTGCTCTGCCAAGACCAAGGAAGGCGTGCGCGAGGTCTTCGAGACGGCCACGCGCGCCGCGCTGCAGAAGCGCTACGGCTCCCAGAACGGCTGCATCAACTGCTGCAAGGTGCTATGAG

Ensembl | human accession no.

ENSG00000143878

NCBI accession no.

NM_004040

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RHOB(388) , RHOB(388)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Olivier Calvayrac et al.
EMBO molecular medicine, 9(2), 238-250 (2016-12-23)
Although lung cancer patients harboring EGFR mutations benefit from treatment with EGFR-tyrosine kinase inhibitors (EGFR-TKI), most of them rapidly relapse. RHOB GTPase is a critical player in both lung carcinogenesis and the EGFR signaling pathway; therefore, we hypothesized that it
Li-Juan Wei et al.
Chemico-biological interactions, 289, 9-14 (2018-04-17)
MicroRNAs (miRNAs) can function as tumor suppressor or oncogenic genes. The putative targets of miR-223 include tumor suppressor gene, RhoB. Here we sought to investigate the role of miR-223-RhoB signaling pathway in proliferation of colon cancer. We used Western blot
Shariq S Ansari et al.
Cellular oncology (Dordrecht), 40(1), 89-96 (2016-11-05)
Recently, we found that erufosine (erucylphospho-N,N,N trimethylpropylammonium) can induce up-regulation of RhoB expression in oral squamous carcinoma (OSCC) cells, thereby hinting at a tumor suppressive role. Therefore, we aimed to evaluate the role of RhoB in the tumor suppressive mode
Manon C A Pronk et al.
Molecular biology of the cell, 30(5), 607-621 (2019-01-03)
Rho GTPases control both the actin cytoskeleton and adherens junction stability and are recognized as essential regulators of endothelial barrier function. They act as molecular switches and are primarily regulated by the exchange of GDP and GTP. However, posttranslational modifications

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service