Skip to Content
Merck
All Photos(1)

Key Documents

EHU119251

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF15

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAACTTCTCGTCGCCAAAATGCCCAGTTGGGTATCTGGGTGATAGGCTGGTTGGCCGGCGGGCATATCACATGCTGCCCTCACCCGTCTCTGAAGATGACAGCGATGCCTCCAGCCCCTGCTCCTGTTCCAGTCCCGACTCTCAAGCCCTCTGCTCCTGCTATGGTGGAGGCCTGGGCACCGAGAGCCAGGACAGCATCTTGGACTTCCTATTGTCCCAGGCCACGCTGGGCAGTGGCGGGGGCAGCGGCAGTAGCATTGGGGCCAGCAGTGGCCCCGTGGCCTGGGGGCCCTGGCGAAGGGCAGCGGCCCCTGTGAAGGGGGAGCATTTCTGCTTGCCCGAGTTTCCTTTGGGTGATCCTGATGACGTCCCACGGCCCTTCCAGCCTACCCTGGAGGAGATTGAAGAGTTTCTGGAGGAGAACATGGAGCCTGGAGTCAAGGAGGTCCCTGAGGGCAACAGCAAGGACTTGGATGCCTGCAGCCAGCTCTCAGCTGGGCCACACAAGAGCCACCTCCATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mi-Yeon Yu et al.
Experimental cell research, 386(1), 111706-111706 (2019-11-08)
Krüppel-like factor 15 (KLF15) is a well-known transcription factor associated with podocyte injury and fibrosis. Recently, hypertensive nephropathy was discovered to be closely related to podocyte injury and fibrosis. However, methods to stimulate hypertension in vitro are lacking. Here, we
Deepesh Pandey et al.
Arteriosclerosis, thrombosis, and vascular biology, 38(4), 913-926 (2018-02-24)
KLF15 (Kruppel-like factor 15) has recently been shown to suppress activation of proinflammatory processes that contribute to atherogenesis in vascular smooth muscle, however, the role of KLF15 in vascular endothelial function is unknown. Arginase mediates inflammatory vasculopathy and vascular injury
Seung Seok Han et al.
International journal of molecular medicine, 42(3), 1593-1602 (2018-06-15)
Krüppel‑like factor 15 (KLF15), also known as kidney‑enriched transcription factor, is known to participate in podocyte differentiation. However, the role of KLF15 in chronic podocyte injury remains incompletely understood, particularly in proteinuric disease models. In the present study, the 5/6 nephrectomy
Peter O Oladimeji et al.
Biochemical pharmacology, 160, 92-109 (2018-12-20)
The pregnane X receptor (PXR) is a principal xenobiotic receptor crucial in the detection, detoxification, and clearance of toxic substances from the body. PXR plays a vital role in the metabolism and disposition of drugs, and elevated PXR levels contribute to cancer

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service