Skip to Content
Merck
All Photos(1)

Key Documents

EHU113561

Sigma-Aldrich

MISSION® esiRNA

targeting human NOTCH2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGTGTCGAGATGGCTATGAACCCTGTGTAAATGAAGGAATGTGTGTTACCTACCACAATGGCACAGGATACTGCAAATGTCCAGAAGGCTTCTTGGGGGAATATTGTCAACATCGAGACCCCTGTGAGAAGAACCGCTGCCAGAATGGTGGGACTTGTGTGGCCCAGGCCATGCTGGGGAAAGCCACGTGCCGATGTGCCTCAGGGTTTACAGGAGAGGACTGCCAGTACTCAACATCTCATCCATGCTTTGTGTCTCGACCCTGCCTGAATGGCGGCACATGCCATATGCTCAGCCGGGATACCTATGAGTGCACCTGTCAAGTCGGGTTTACAGGTAAGGAGTGCCAATGGACGGATGCCTGCCTGTCTCATCCCTGTGCAAATGGAAGTACCTGTACCACTGTGGCCAACCAGTTCTCCTGCAAATGCCTCACAGGCTTCACAGGGCAGAAATGTGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoyuan Wang et al.
Stem cell research & therapy, 9(1), 327-327 (2018-11-25)
Lung cancer stem cells have the ability to self-renew and are resistant to conventional chemotherapy. MicroRNAs (miRNAs) regulate and control the expression and function of many target genes; therefore, miRNA disorders are involved in the pathogenesis of human diseases, such
Rulan Bai et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(6), 3371-3384 (2018-02-03)
Embryo implantation into the uterine endometrium is required for pregnancy establishment in most mammals. By using global expression analysis, we investigated the molecules that are related to epithelial-mesenchymal transition (EMT) in noninvasive bovine trophoblasts and found that the transcription factor
Mercedes Tomé et al.
Stem cell research, 35, 101390-101390 (2019-02-15)
Notch signalling regulates neural stem cell (NSC) proliferation, differentiation and survival for the correct development and functioning of the central nervous system. Overactive Notch2 signalling has been associated with poor prognosis of aggressive brain tumours, such as glioblastoma multiforme (GBM).
Jie Deng et al.
Journal of experimental & clinical cancer research : CR, 38(1), 2-2 (2019-01-05)
Glioblastomas multiforme (GBM) is the most devastating primary intracranial malignancy lacking effective clinical treatments. Notch2 has been established to be a prognostic marker and probably involved in GBM malignant progression. N-acetylcysteine (NAC), a precursor of intracellular glutathione (GSH), has been
Jeeranan Manokawinchoke et al.
Scientific reports, 7(1), 10124-10124 (2017-09-02)
Notch signaling regulates diverse biological processes in dental pulp tissue. The present study investigated the response of human dental pulp cells (hDPs) to the indirect immobilized Notch ligand Jagged1 in vitro. The indirect immobilized Jagged1 effectively activated Notch signaling in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service