Skip to Content
Merck
All Photos(1)

Key Documents

EHU094691

Sigma-Aldrich

MISSION® esiRNA

targeting human CD44

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTAAAGGGATTCCCATCATTGGAATCTTATCACCAGATAGGCAAGTTTATGACCAAACAAGAGAGTACTGGCTTTATCCTCTAACCTCATATTTTCTCCCACTTGGCAAGTCCTTTGTGGCATTTATTCATCAGTCAGGGTGTCCGATTGGTCCTAGAACTTCCAAAGGCTGCTTGTCATAGAAGCCATTGCATCTATAAAGCAACGGCTCCTGTTAAATGGTATCTCCTTTCTGAGGCTCCTACTAAAAGTCATTTGTTACCTAAACTTATGTGCTTAACAGGCAATGCTTCTCAGACCACAAAGCAGAAAGAAGAAGAAAAGCTCCTGACTAAATCAGGGCTGGGCTT

Ensembl | human accession no.

ENSG00000026508

NCBI accession no.

NM_001001391

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD44(960) , CD44(960)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zenghui Fang et al.
Experimental cell research, 382(1), 111462-111462 (2019-06-14)
Scaffolding adaptor Gab2 is overexpressed in a subset of high-grade ovarian cancer. Our published work shows that Gab2 via PI3K enhances migratory behaviors and epithelial to mesenchymal transition (EMT) features of ovarian cancer cells in vitro. However, it is still
Doohyung Lee et al.
Hepatology (Baltimore, Md.), 61(6), 1978-1997 (2015-01-30)
Tumor metastasis involves circulating and tumor-initiating capacities of metastatic cancer cells. Epithelial-mesenchymal transition (EMT) is related to self-renewal capacity and circulating tumor cell (CTC) characteristics for tumor metastasis. Although tumor metastasis is a life-threatening, complicated process that occurs through circulation
Anna-Karin Ekman et al.
The Journal of investigative dermatology, 139(7), 1564-1573 (2019-01-27)
Psoriasis is an inflammatory skin disorder characterized by the hyperproliferation of basal epidermal cells. It is regarded as T-cell mediated, but the role of keratinocytes (KCs) in the disease pathogenesis has reemerged, with genetic studies identifying KC-associated genes. We applied
Gan Yu et al.
The Journal of urology, 192(4), 1229-1237 (2014-05-29)
We investigated the potential functions of miR-34a in CD44 transcriptional complexes in renal cell carcinoma. We detected miR-34a expression by quantitative real-time polymerase chain reaction. Oligonucleotides were used to over express miR-34a. Cell proliferation and xenograft assays, colony formation and
Jingying Zheng et al.
Theranostics, 7(5), 1373-1388 (2017-04-25)
CD44 and EpCAM play crucial roles in intraperitoneal ovarian cancer development. In this study, we developed an RNA-based bispecific CD44-EpCAM aptamer that is capable of blocking CD44 and EpCAM simultaneously by fusing single CD44 and EpCAM aptamers with a double
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service