Skip to Content
Merck
All Photos(1)

Key Documents

EHU090071

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC9 (3)

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGTTCTCCAGGCTCTGGTCCCAGTTCACCAAACAATGGGCCAACTGGAAGTGTTACTGAAAATGAGACTTCGGTTTTGCCCCCTACCCCTCATGCCGAGCAAATGGTTTCACAGCAACGCATTCTAATTCATGAAGATTCCATGAACCTGCTAAGTCTTTATACCTCTCCTTCTTTGCCCAACATTACCTTGGGGCTTCCCGCAGTGCCATCCCAGCTCAATGCTTCGAATTCACTCAAAGAAAAGCAGAAGTGTGAGACGCAGACGCTTAGGCAAGGTGTTCCTCTGCCTGGGCAGTATGGAGGCAGCATCCCGGCATCTTCCAGCCACCCTCATGTTACTTTAGAGGGAAAGCCACCCAACAGCAGCCACCAGGCTCTCCTGCAGCATTTATTATTGAAAGAACAAATGCGACAGCAAAAGCTT

Ensembl | human accession no.

ENSG00000048052

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HDAC9(9734) , HDAC9(9734)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiqiang Yu et al.
Oncology letters, 17(3), 3296-3304 (2019-03-15)
Gastric cancer (GC) is a common life-threatening cancer type worldwide, with an increasing prevalence and a high rate of mortality. Due to limitations in clinical treatment, surgery has become the most efficient strategy for the treatment of GC. It is
Yue Yang et al.
The Journal of nutritional biochemistry, 40, 172-177 (2016-12-05)
Activation of hepatic stellate cells (HSCs) is critical for liver fibrosis development. Previously, we showed that astaxanthin (ASTX), a xanthophyll carotenoid, has antifibrogenic effects in LX-2 cells, a human HSC cell line. We sought to determine the effect of ASTX
Gaoyan Wang et al.
Molecular carcinogenesis, 59(12), 1392-1408 (2020-10-21)
Countless evidence suggests that long noncoding RNAs (lncRNAs) are involved in human malignant cancers, including esophageal squamous cell carcinoma (ESCC), although their exact function remains unclear. In the present study, we aimed to investigate the roles and molecular mechanisms of the
Changliang Shan et al.
Cell death & disease, 10(7), 525-525 (2019-07-10)
4-hydroxyphenylpyruvate dioxygenase (HPD) is an important modifier of tyrosine metabolism. However, the precise contribution of HPD to cancer metabolism and tumorigenesis remains unclear. In this study, we found that HPD was highly expressed in lung cancer and its higher expression
Dong-Qin Chen et al.
Therapeutic advances in medical oncology, 10, 1758835918783132-1758835918783132 (2018-07-24)
Treatment of metastatic castration-resistant prostate cancer (mCRPC) with docetaxel often fails due to the emergence of chemoresistance. Thus, restoring chemosensitivity to docetaxel-based therapies remains a challenge in mCRPC treatment. microRNA (miR)-451 expression was measured in docetaxel-treated prostate cancer cells and
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service