Skip to Content
Merck
All Photos(1)

Key Documents

EHU077611

Sigma-Aldrich

MISSION® esiRNA

targeting human VAV3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGTGGAGTCAGCCATCTCTAGTTTAGACTACATTTCTAAGACAAAAGAAGATGTCAAACTGAAATTAGAGGAATGTTCCAAAAGAGCAAATAATGGGAAATTTACTCTTCGAGACTTGCTTGTGGTTCCTATGCAACGTGTTTTAAAGTACCACCTTCTCCTCCAGGAACTGGTCAAACATACCACTGATCCGACTGAGAAGGCAAATCTGAAACTGGCTCTTGATGCCATGAAGGACTTGGCACAATATGTGAATGAAGTGAAAAGAGATAATGAGACCCTTCGTGAAATTAAACAGTTTCAGCTATCTATAGAGAATTTGAACCAACCAGTTTTGCTTTTTGGACGACCTCAGGGAGATGGTGAAATTCGAATAACCACTCTAGACAAGCATACCAAACAAGAAAGGCATATCTTCTTATTTGATTTGGCAGTGATCGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Takeo Nomura et al.
Molecular cancer, 12, 27-27 (2013-04-10)
The Vav family of Rho/Rac guanosine nucleotide exchange factors comprises three members in mammalian cells. Vav3 enhances androgen receptor (AR) activity during progression to androgen independence in prostate cancer. We examined Vav3 small interfering RNA (siRNA) effects on cell proliferation
Jie Sha et al.
Endocrinology and metabolism (Seoul, Korea), 29(3), 363-370 (2014-10-14)
The role of small GTPase molecules is poorly understood under high glucose conditions. We analyzed the expression pattern of Vav3 in skeletal muscle C2C12 cells under high glucose culture condition with reverse transcription-polymerase chain reaction and Western blot analysis. We
J K Liu et al.
Cell death and differentiation, 21(8), 1325-1339 (2014-05-17)
Glioblastoma is the most common primary intrinsic brain tumor and remains incurable despite maximal therapy. Glioblastomas display cellular hierarchies with self-renewing glioma-initiating cells (GICs) at the apex. To discover new GIC targets, we used in vivo delivery of phage display

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service