Skip to Content
Merck
All Photos(1)

Key Documents

EHU046961

Sigma-Aldrich

MISSION® esiRNA

targeting human CALR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTCAGTTCCGGCAAGTTCTACGGTGACGAGGAGAAAGATAAAGGTTTGCAGACAAGCCAGGATGCACGCTTTTATGCTCTGTCGGCCAGTTTCGAGCCTTTCAGCAACAAAGGCCAGACGCTGGTGGTGCAGTTCACGGTGAAACATGAGCAGAACATCGACTGTGGGGGCGGCTATGTGAAGCTGTTTCCTAATAGTTTGGACCAGACAGACATGCACGGAGACTCAGAATACAACATCATGTTTGGTCCCGACATCTGTGGCCCTGGCACCAAGAAGGTTCATGTCATCTTCAACTACAAGGGCAAGAACGTGCTGATCAACAAGGACATCCGTTGCAAGGATGATGAGTTTACACACCTGTACACACTGATTGTGCGGCCAGACAACACCTATGAGGTGAAGATTGACAACAGCCAGGTGGAGTCCGGCTCCTTGGAAGACGATTGGGACTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shuang Liu et al.
Immunology and cell biology, 92(9), 752-760 (2014-06-18)
The regulated control of Ca(2+) influx is essential for the activation and function of the adaptive immune response, as Ca(2+) is a key regulator of important transcription factors. To determine whether Ca(2+) release-activated Ca(2+) (CRAC) channels contribute to the abnormal
Ruo Feng et al.
Diagnostic pathology, 10, 149-149 (2015-08-27)
Hepatocellular carcinoma (HCC) is one of the most frequent cancers in the world. Calreticulin(CRT) is aberrantly overexpressed in many human cancer cells. The function of CRT in HCC cells remains unclear. We attempted to investigate the effects and the underlying
Saurabh Vig et al.
Cell cycle (Georgetown, Tex.), 14(14), 2274-2284 (2015-05-07)
Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service