Skip to Content
Merck
All Photos(1)

Key Documents

EHU002651

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP1LC3B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAAGTGAGCACATTCAGCTTTGGAAACTATATTATTTAATGTAGGCTAGCTTGTTTTCAAATTTTAAAAGTTTAAAAATAAAATACTTTGCATTCTAAGTTGCCAATAAAATAGACCTTCAAGTTATTTTAATGCTCTTTTCTCACTAATAGGAACTTGTAATTCCAGCAGTAATTTAAAGGCTTTCAGAGAGACCCTGAGTCTTCTCTTCAGGTTCACAAAACCCGCCGCCTTTTTGGGTAGAAGTTTTCTACTCAGCTAGAGAGATCTCCCTAAGAGGATCTTTAGGCCTGAGTTGTGAAGCGCAACCCCCGCAAAACGCATTTGCCATCACAGTTGGCACAAACGCAGGGTAAACGGGCTGTGTGAGAAAACGGCCCTGACTGTAAACTGCTGAAGGTCCCTGACTCCTAAGAGAACCACACCCAAAGTCCTCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tamotsu Tsukahara et al.
BioMed research international, 2013, 204973-204973 (2013-11-30)
Our previous study demonstrated that PTB-associated splicing factor (PSF) is an important regulator of cell death and plays critical roles in the survival and growth of colon cancer cells. However, the molecular mechanism that activates these downstream signaling events remains
Alok Ranjan et al.
Scientific reports, 6, 26165-26165 (2016-05-18)
Pancreatic tumors exhibit enhanced autophagy as compared to any other cancer, making it resistant to chemotherapy. We evaluated the effect of penfluridol against pancreatic cancer. Penfluridol treatment induced apoptosis and inhibited the growth of Panc-1, BxPC-3 and AsPC-1, pancreatic cancer
Sheeja Aravindan et al.
Journal of biomedical science, 22, 28-28 (2015-04-22)
Identifying the drug-deliverables that target autophagy is crucial to finding a cure for pancreatic cancer (PC), as activated autophagy is associated with poor patient outcomes. Our recent studies recognized the anti-PC potential of an antioxidant-rich collection of seaweed polyphenols and
S Kumar et al.
Cell death & disease, 4, e889-e889 (2013-11-02)
Angiogenesis has a key role in the tumor progression and metastasis; targeting endothelial cell proliferation has emerged as a promising therapeutic strategy for the prevention of cancer. Previous studies have revealed a complex association between the process of angiogenesis and
Saroj Nepal et al.
Biomolecules & therapeutics, 22(5), 384-389 (2014-11-22)
Adiponectin, an adipokine predominantly secreted from adipose tissue, exhibits diverse biological responses, including metabolism of glucose and lipid, and apoptosis in cancer cells. Recently, adiponectin has been shown to modulate autophagy as well. While emerging evidence has demonstrated that autophagy

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service