Skip to Content
Merck
All Photos(1)

Key Documents

EMU041761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nod1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTTGCTTTAGCCGTCTCACGGTTATCAGACTCAGCGTCAACCAGATCACCGACACGGGGGTGAAGGTGCTATGTGAGGAACTGACCAAGTATAAGATCGTGACGTTCCTGGGTTTATACAACAACCAGATAACTGATATCGGAGCCAGGTATGTGGCCCAAATCCTGGATGAATGCAGAGGCCTCAAGCACCTTAAACTAGGGAAAAACAGAATAACAAGTGAGGGCGGGAAGTGTGTGGCTTTGGCTGTGAAGAACAGCACCTCCATCGTTGATGTTGGGATGTGGGGTAATCAGATTGGAGACGAAGGGGCAAAGGCCTTCGCAGAGGCATTGAAGGACCACCCCAGCCTGACCACTCTCAGTCTTGCATTCAATGGCATCTCTCCGGAGGGAGGGAAGAGCCTTGCGCAGGCCCTGAAGCAGAACACCACACTGACAGTAATCTGGCTGACCAAAAATGAACTTAATGATGAGTCTGCAGAGTGCTTCGCTGAGATGCTGAGAGTGAACCAGACGCTACGGCATTTAT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

M Wan et al.
Molecular oral microbiology, 30(5), 399-410 (2015-05-06)
Porphyromonas gingivalis, an important periodontal pathogen, has been proved to actively invade cells, induce endothelial cell activation, and promote development of atherosclerosis. Innate immune surveillance, which includes the activity of nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) and Toll-like receptors (TLRs)
Yuting Zhang et al.
Experimental eye research, 127, 170-178 (2014-08-12)
Fungal keratitis is a serious vision-threatening disease caused by fungi after corneal epithelium damage. We have previously shown a role of cell surface TLRs in Aspergillus fumigatus (A. fumigatus) keratitis. In the present study we showed that Human telomerase-immortalized corneal epithelial

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service