Skip to Content
Merck
All Photos(1)

Key Documents

EHU080501

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGAP4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGGAGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCCCTGGTGGTGGAGAGCTGCATTCGCTTCATCAACCTCAATGGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

P-S Hu et al.
Oncogene, 36(33), 4706-4718 (2017-04-11)
Polycomb group (PcG) proteins play an important role in development and stem cell maintenance, and their dysregulation have been closely linked to oncogenesis and cancer stem cell phenotypes. Here, we found that nervous system polycomb 1 (NSPc1) was highly expressed
Dabin Lee et al.
Cell death & disease, 9(5), 495-495 (2018-05-03)
Chemokine CCL4 (MIP-1β) is released from osteoblast cells to restore the homeostasis of hematopoietic stem cells during the activation of bone marrow. In this study, we investigated the function of CCL4 and its receptor CCR5 during osteoclastogenesis. CCL4 promoted the
Yehua Shen et al.
Carcinogenesis, 40(11), 1405-1414 (2019-04-09)
β-catenin is a subunit of the cadherin protein complex and acts as an intracellular signal transducer in the Wnt signaling pathway that mediates multiple cellular processes, such as cell migration and invasion. HDAC2 (histone deacetylase 2), a deacetylase that maintains
Yehua Shen et al.
OncoTargets and therapy, 12, 5003-5012 (2019-07-16)
The phenomenon that cancer cells avidly exhibit glycolysis with lactate secretion and decrease in mitochondrial activity under aerobic conditions is known historically as the Warburg effect. Rho GTPase-activating protein 4 (ARHGAP4) is an important negative regulator of the Rho signaling
Y-B Yu et al.
Acta physiologica (Oxford, England), 219(2), 465-477 (2016-05-28)
Erythropoietin (EPO), the key hormone involved in erythropoiesis, beneficially affects endothelial cells (ECs), but the detailed mechanisms are yet to be completely understood. In this study, we investigated the role of transient receptor potential vanilloid type 1 (TRPV1), a ligand-gated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service