Skip to Content
Merck
All Photos(1)

Key Documents

EHU035251

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAGGCAGGCTGTTAATGCCACTGGGCACCTTTCAGACACACTTTGGCTGATCCCCATCACATTCCTGACCATCGGCTATGGTGACGTGGTGCCGGGCACCATGTGGGGCAAGATCGTCTGCCTGTGCACTGGAGTCATGGGTGTCTGCTGCACAGCCCTGCTGGTGGCCGTGGTGGCCCGGAAGCTGGAGTTTAACAAGGCAGAGAAGCACGTGCACAACTTCATGATGGATATCCAGTATACCAAAGAGATGAAGGAGTCCGCTGCCCGAGTGCTACAAGAAGCCTGGATGTTCTACAAACATACTCGCAGGAAGGAGTCTCATGCTGCCCGCAGGCATCAGCGCAAGCTGCTGGCCGCCATCAACGCGTTCCGCCAGGTGCGGCTGAAACACCGGAAGCTCCGGGAACAAGTGAACTCCATGGTGGACATCTCCAAGATGCACATGATCCTGTATGACCTGCAGCAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yu-Dong Fei et al.
Theranostics, 9(22), 6396-6411 (2019-10-08)
Effective therapeutic targets against post-myocardial infarction (MI) arrhythmias remain to be discovered. We aimed to investigate the role of macrophages in post-MI arrhythmias. Methods: Mononuclear cell accumulation, macrophage polarization from M0 to M1 subset, and gap junction formation were analyzed
Alban Girault et al.
Respiratory research, 16, 100-100 (2015-09-04)
Extensive alveolar epithelial injury and remodelling is a common feature of acute lung injury and acute respiratory distress syndrome (ARDS) and it has been established that epithelial regeneration, and secondary lung oedema resorption, is crucial for ARDS resolution. Much evidence
Chunling Huang et al.
Scientific reports, 6, 23884-23884 (2016-04-01)
Autophagy is emerging as an important pathway in many diseases including diabetic nephropathy. It is acknowledged that oxidative stress plays a critical role in autophagy dysfunction and diabetic nephropathy, and KCa3.1 blockade ameliorates diabetic renal fibrosis through inhibiting TGF-β1 signaling
Yu Liu et al.
Journal of Cancer, 6(7), 643-651 (2015-06-17)
The intermediate conductance calcium-activated potassium channel KCa3.1 plays an important role in regulating cell proliferation and migration. However, the role of KCa3.1 channel in human hepatocellular carcinoma remained unknown. This study was therefore performed to investigate the effects of KCa3.1
Etmar Bulk et al.
Oncotarget, 8(68), 112268-112282 (2018-01-20)
Early metastasis leads to poor prognosis of lung cancer patients, whose 5-year survival rate is only 15%. We could recently show that the Ca2+ sensitive K+ channel KCa3.1 promotes aggressive behavior of non-small cell lung cancer (NSCLC) cells and that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service