Skip to Content
Merck
All Photos(1)

Key Documents

EHU020381

Sigma-Aldrich

MISSION® esiRNA

targeting human CADM4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGATAACGGCACCTACACTTGCGAGGCGTCCAATAAGCACGGCCATGCGAGGGCGCTCTACGTACTTGTGGTCTACGACCCTGGTGCGGTGGTAGAGGCTCAGACGTCGGTTCCCTATGCCATTGTGGGCGGCATCCTGGCGCTGCTGGTGTTTCTGATCATATGTGTGCTAGTGGGCATGGTCTGGTGCTCGGTACGGCAGAAGGGTTCCTATCTGACCCACGAAGCCAGTGGCTTGGATGAACAGGGAGAAGCAAGAGAAGCCTTCCTCAATGGCAGCGACGGACACAAGAGGAAAGAGGAATTCTTCATCTGACCCTATCCCCACCCCAGGCCTAGGCCTGGGCCTGGGCTGGGGTCCCCCCCACTGCCAGCTGCAAGGAACCAGCAAAGACATTTACCAGAGTCTGGGATGGTGGGCTTCTCCCCCCACCACTAACACCTCAGACGCTTGGGCAGGGATGGGGGTGTTGGATGCCTGGATCTCTGTAAGGGCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fang Luo et al.
The international journal of biochemistry & cell biology, 123, 105750-105750 (2020-04-24)
Cell adhesion molecule 4 (CADM4) is downregulated in many human cancers. However, CADM4 expression levels in human non-small cell lung cancer (NSCLC) tissues and its roles in NSCLC progression remain unknown. Our study aims to address these issues. We examined
Shruthy Suresh et al.
PLoS genetics, 13(3), e1006650-e1006650 (2017-03-09)
Hepatocellular carcinoma (HCC) is the fifth most common solid tumor in the world and the third leading cause of cancer-associated deaths. A Sleeping Beauty-mediated transposon mutagenesis screen previously identified mutations that cooperate with MYC to accelerate liver tumorigenesis. This revealed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service