Skip to Content
Merck
All Photos(1)

Key Documents

EHU158351

Sigma-Aldrich

MISSION® esiRNA

targeting human PMEPA1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGTGCCTAGCTTGGTGAGGTTACTCCTGCTCCTCCAACCTTTTTTTGCCAAGGTTTGTACACGACTCCCATCTAGGCTGAAAACCTAGAAGTGGACCTTGTGTGTGTGCATGGTGTCAGCCCAAAGCCAGGCTGAGACAGTCCTCATATCCTCTTGAGCCAAACTGTTTGGGTCTCGTTGCTTCATGGTATGGTCTGGATTTGTGGGAATGGCTTTGCGTGAGAAAGGGGAGGAGAGTGGTTGCTGCCCTCAGCCGGCTTGAGGACAGAGCCTGTCCCTCTCATGACAACTCAGTGTTGAAGCCCAGTGTCCTCAGCTTCATGTCCAGTGGATGGCAGAAGTTCATGGGGTAGTGGCCTCTCAAAGGCTGGGCGCATCCCAAGACAGCCAGCAGGTTGTCTCTGGAAACGACCAGAGTTAAGCTCTCGGCTTCTCTGC

Ensembl | human accession no.

ENSG00000124225

NCBI accession no.

NM_199169

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PMEPA1(56937) , PMEPA1(56937)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Riezki Amalia et al.
Cellular signalling, 59, 24-33 (2019-03-21)
Transmembrane prostate androgen-induced protein (TMEPAI) is a type I transmembrane protein induced by several intracellular signaling pathways such as androgen, TGF-β, EGF, and Wnt signaling. It has been reported that TMEPAI functions to suppress TGF-β and androgen signaling but here
Yuyin Li et al.
Cell proliferation, 49(6), 710-719 (2016-11-04)
TMEPAI (transmembrane prostate androgen-induced protein) has been reported to be overexpressed during tumour progression; however, little is known concerning transcriptional mechanisms regulating TMEPAI gene expression. In this study, the TMEPAI gene promoter has been identified and characterized, and the effects
Noboru Funakubo et al.
Journal of cellular physiology, 233(4), 3105-3118 (2017-08-13)
Osteoclasts are multinucleated cells formed by fusion of preosteoclasts (POCs) derived from cells of the monocyte/macrophage lineage. We have reported a culture system that supports the formation of POCs from stroma-depleted rat bone marrow cells. Global gene expression analysis of
Hua Li et al.
Oncotarget, 6(17), 15137-15149 (2015-04-18)
Androgen Receptor (AR) is the male hormone receptor and a nuclear transcription factor which plays a central role in the growth of normal and malignant prostate gland. Our earlier studies defined a mechanistic model for male hormone dependent regulation of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service