Skip to Content
Merck
All Photos(1)

Key Documents

EHU158181

Sigma-Aldrich

MISSION® esiRNA

targeting human SUV39H1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTGCTTACAGTGCTGGGTAGTGTTGGCCCTAAGAGCTGTAGGGTCTCTTCTTCAGGGCTGCATATCTGAGAAGTGGATGCCCACATGCCACTGGAAGGGAAGTGGGTGTCCATGGGCCACTGAGCAGTGAGAGGAAGGCAGTGCAGAGCTGGCCAGCCCTGGAGGTAGGCTGGGACCAAGCTCTGCCTTCACAGTGCAGTGAAGGTACCTAGGGCTCTTGGGAGCTCTGCGGTTGCTAGGGGCCCTGACCTGGGGTGTCATGACCGCTGACACCACTCAGAGCTGGAACCAAGATCTAGATAGTCCGTAGATAGCACTTAGGACAAGAATGTGCATTGATGGGGTGGTGATGAGGTGCCAGGCACTGGGTAGAGCACCTGGTCCACGTGGATTGTCTCAGGGAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kai Zhao et al.
Cell death & disease, 10(12), 877-877 (2019-11-23)
Runt-Related Transcription Factor 1 (RUNX1) is highly expressed in the Mesenchymal (Mes) subtype of glioblastoma (GBM). However, the specific molecular mechanism of RUNX1 in Mes GBM remains largely elusive. In this study, cell and tumor tissue typing were performed by
Xianliang Lai et al.
Cancer biomarkers : section A of Disease markers, 20(4), 453-460 (2017-09-28)
Epigenetic alteration plays critical roles in gliomagenesis by regulating gene expression through modifications of Histones and DNA. Trimethylation of H3K9, an essential repressed transcription mark, and one of its methyltransferase, SUV39H1, are implicated in glioma pathogenesis and progression. We find
Justin S Becker et al.
Molecular cell, 68(6), 1023-1037 (2017-12-23)
Heterochromatin is integral to cell identity maintenance by impeding the activation of genes for alternate cell fates. Heterochromatic regions are associated with histone 3 lysine 9 trimethylation (H3K9me3) or H3K27me3, but these modifications are also found in euchromatic regions that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service