Skip to Content
Merck
All Photos(1)

Key Documents

EHU133121

Sigma-Aldrich

MISSION® esiRNA

targeting human RBM3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGCACCGAAGCATCTTATTTTATAGTATATCAACCTTTTGTTTTTAAATTGACCTGCCAAGGTAGCTGAAGACCTTTTAGACAGTTCCATCTTTTTTTTTAAATTTTTTCTGCCTATTTAAAGACAAATTATGGGACGTTTGTAGAACCTGAGTATTTTTCTTTTTACCAGTTTTTTAGTTTGAGCTCTTAGGTTTATTGGAGCTAGCAATAATTGGTTCTGGCAAGTTTGGCCAGACTGACTTCAAAAAATTAATGTGTATCCAGGGACATTTTAAAAACCTGTACACAGTGTTTATTGTGGTTAGGAAGCAATTTCCCAATGTACCTATAAGAAATGTGCATCAAGCCAGCCTGACCAACATGGTGAAACCCCATCTGTACTAAACATAAAAAAATTAGCCTGGCATGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Delphine Laustriat et al.
Molecular therapy. Nucleic acids, 4, e262-e262 (2015-11-04)
Major physiological changes are governed by alternative splicing of RNA, and its misregulation may lead to specific diseases. With the use of a genome-wide approach, we show here that this splicing step can be modified by medication and demonstrate the
Zhiming Cui et al.
Journal of molecular neuroscience : MN, 54(2), 252-263 (2014-03-29)
Hypoxia and other adverse conditions are usually encountered by rapidly growing cells. The RNA-binding motif protein 3 (RBM3) is induced by low temperature and hypoxia. However, its expression and function in spinal cord injury are still unclear. To investigate the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service